version
PlantPromoterDB promoter information of AT5G08670.1

Summary of Gene (AT5G08670.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G08670  TAIR      NCBI 
Gene model AT5G08670.1  
Description Encodes the mitochondrial ATP synthase beta-subunit. This subunit is encoded by a multigene family of three members (At5g08670, At5g08680, At5g08690) that shared 98% sequence identity at the amino acid level.  
#
#

Overview

Focused view (chromosome 5: 2822149-2820950)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G08670.1                      5'->3' (-)
Promoter sequence











 
AT5G08680.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G08670.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA204-2821165-16

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-2821208-59
TSS cloneTclone-2821204-55
TSS cloneCclone-2821195-46
TSS cloneTclone-2821187-38
TSS cloneTclone-2821177-28
TSS cloneTclone-2821175-26
TSS cloneCclone-2821174-25
TSS cloneCclone-2821172-23
TSS cloneTclone-2821169-20
TSS cloneTclone-2821167-18
TSS cloneAclone-2821165-16
TSS cloneAclone-2821164-15
TSS cloneCclone-2821156-7

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTCTCC-282111628211253324
Y PatchCTTTCTCTCTCTCTCTC-28211662821182-17-33
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGCCTTT-28212212821228-72-79
 AtREG359GGGCCTTT PPDB MotifGCCCA  PLACE MotifGGGCC 
REGATAGGCCCAACTAAGCCCATTAACTAAGCCCAC-28212542821286-105-137
 AtREG362ATAGGCCC                          PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358 TAGGCCCA                         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  AGGCCCAA                        PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG449   GGCCCAAC                       PPDB MotifGCCCA, CCAACGG  PLACE MotifGGGCC, TGGGCY 
 AtREG607    GCCCAACT                      PPDB MotifGCCCA  PLACE Motif 
 AtREG634          CTAAGCCC     CTAAGCCC   PPDB MotifGCCCA  PLACE Motif 
 AtREG426           TAAGCCCA     TAAGCCCA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378            AAGCCCAT              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372             AGCCCATT             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357              GCCCATTA            PPDB MotifGCCCA  PLACE Motif 
 AtREG396               CCCATTAA           PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG518                         AAGCCCAC PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG2+2821922AT5G08680.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone+2821926AT5G08680.1
TSS cloneAclone+2821928AT5G08680.1
TSS cloneTclone+2821929AT5G08680.1
TSS cloneAclone+2821932AT5G08680.1
TSS cloneAclone+2821948AT5G08680.1
TSS cloneGclone+2821949AT5G08680.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxTATATAGAG+28218952821903AT5G08680.1
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCGTTTTGA+28217642821771AT5G08680.1
 AtREG653CGTTTTGA PPDB MotifAAACG(C/G)  PLACE Motif 
REGTCACACGTGTCG+28218232821834AT5G08680.1
 AtREG588TCACACGT    ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG460 CACACGTG   ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG366   CACGTGTC ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACGTGKC, ACACNNG, ACGTGTC 
 AtREG478    ACGTGTCGABA, DREB1Aox, Drought PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.