version
PlantPromoterDB promoter information of AT5G09230

Summary of Gene (AT5G09230)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G09230  TAIR      NCBI 
Gene model AT5G09230  
Description Encodes SRT2, a member of the SIR2 (sirtuin) family HDAC (histone deacetylase) (SRT1/AT5g55760, SRT2/AT5G09230).  
#
#

Overview

Focused view (chromosome 5: 2871181-2872380)

Genome position     
from initiation codon
AT5G09230.1         
AT5G09230.2         
AT5G09230.3         
AT5G09230.4         
AT5G09230.5         
AT5G09230.6         
AT5G09230.7         
TSS from cDNA
TSS information
AT5G09230                        5'->3' (+)
Promoter sequence





 
AT5G09225.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G09230

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+2871378-803
TSS clone peakAclone+2871406-775

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAACGACGTCGTTT+28712372871249-944-932
 AtREG493AACGACGTCGTT  PPDB MotifACGT  PLACE MotifACGT 
 AtREG431 ACGACGTCGT   PPDB MotifACGT  PLACE MotifACGT 
 AtREG415     CGTCGTTT PPDB Motif  PLACE Motif 
REGCTACGTGGCT+28712842871293-897-888
 AtREG495CTACGTGG   PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG413 TACGTGGC  PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG450  ACGTGGCTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneCclone-2871198AT5G09225.1
TSS cloneTclone-2871197AT5G09225.1
TSS clone peakTclone-2871193AT5G09225.1
TSS cloneGclone-2871190AT5G09225.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.