version
PlantPromoterDB promoter information of AT5G10370.1

Summary of Gene (AT5G10370.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G10370  TAIR      NCBI 
Gene model AT5G10370.1  
Description helicase domain-containing protein / IBR domain-containing protein / zinc finger protein-related; FUNCTIONS IN: in 6 functions; LOCATED IN: intracellular, chloroplast; CONTAINS InterPro DOMAIN/s: Helicase-associated region (InterPro:IPR007502), Zinc finger, RING-type, conserved site (InterPro:IPR017907), Zinc finger, RING-type (InterPro:IPR001841), Region of unknown function DUF1605 (InterPro:IPR011709), Zinc finger, C6HC-type (InterPro:IPR002867), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (InterPro:IPR002464), DEAD-like helicase, N-terminal (InterPro:IPR014001), Zinc finger, C2H2-type (InterPro:IPR007087), DNA/RNA helicase, C-terminal (InterPro:IPR001650), Helicase, superfamily 1 and 2, ATP-binding (InterPro:IPR014021); BEST Arabidopsis thaliana protein match is: helicase domain-containing protein / IBR domain-containing protein / zinc finger protein-related (TAIR:AT4G01020.1); Has 9428 Blast hits to 8884 proteins in 1026 species: Archae - 13; Bacteria - 1902; Metazoa - 3050; Fungi - 1283; Plants - 712; Viruses - 642; Other Eukaryotes - 1826 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 3260245-3261444)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G10370.1                      5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence









 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G10370.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4+3261162-83
TSS peakA4+3261193-52

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCTTATAAATT+32611253261135-120-110
Y PatchTCTTTCTCTTTC+32611733261184-72-61
Y PatchTCTCTCAT+32611873261194-58-51
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTCCTATAAGT-32602543260264AT5G10360.1
Y PatchCTTCTCTC-32602443260251AT5G10360.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGTAGGCCCAATT-32602873260298AT5G10360.1
 AtREG435GTAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358 TAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352   GGCCCAAT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG418    GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGTTATGGGCCCATAA-32603023260315AT5G10360.1
 AtREG391  ATGGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG422   TGGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG364 TATGGGCCCATA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG394TTATGGGCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGGCCCAAAT-32603203260327AT5G10360.1
 AtREG421GCCCAAAT PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.