version
PlantPromoterDB promoter information of AT5G10630.1

Summary of Gene (AT5G10630.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G10630  TAIR      NCBI 
Gene model AT5G10630.1  
Description elongation factor 1-alpha, putative / EF-1-alpha, putative; FUNCTIONS IN: GTP binding, translation elongation factor activity, GTPase activity, zinc ion binding; INVOLVED IN: biological_process unknown; LOCATED IN: intracellular; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Zinc finger, RanBP2-type (InterPro:IPR001876), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000); BEST Arabidopsis thaliana protein match is: EF-1-alpha-related GTP-binding protein, putative (TAIR:AT1G18070.2); Has 58110 Blast hits to 58057 proteins in 13368 species: Archae - 652; Bacteria - 20622; Metazoa - 14216; Fungi - 8620; Plants - 1274; Viruses - 3; Other Eukaryotes - 12723 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 3359561-3360760)

Genome position     
from initiation codon
AT5G10625.1         
TSS from cDNA
TSS information
AT5G10630.1                      5'->3' (+)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G10630.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTATAGGCCCGTTAAAAGCCCAACA+33600133360036-548-525
 AtREG487TATAGGCC                 PPDB Motif  PLACE Motif 
 AtREG362 ATAGGCCC                PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG429   AGGCCCGT              PPDB MotifACGGGC  PLACE MotifGGGCC 
 AtREG401    GGCCCGTT             PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE MotifGGGCC 
 AtREG399     GCCCGTTA            PPDB MotifACGGGC  PLACE MotifYAACKG, CNGTTR 
 AtREG610       CCGTTAAA          PPDB Motif  PLACE MotifYAACKG, CNGTTR 
 AtREG549           TAAAAGCC      PPDB Motif  PLACE Motif 
 AtREG409            AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376             AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407              AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG574               AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG543                GCCCAACA PPDB MotifGCCCA  PLACE MotifCAACA 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.