version
PlantPromoterDB promoter information of AT5G10690.1

Summary of Gene (AT5G10690.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G10690  TAIR      NCBI 
Gene model AT5G10690.1  
Description pentatricopeptide (PPR) repeat-containing protein / CBS domain-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885), Cystathionine beta-synthase, core (InterPro:IPR000644); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G12775.1); Has 9217 Blast hits to 4059 proteins in 145 species: Archae - 2; Bacteria - 6; Metazoa - 124; Fungi - 115; Plants - 8658; Viruses - 0; Other Eukaryotes - 312 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 3378332-3377133)

Genome position     
from initiation codon
AT5G10700.1         
TSS from cDNA
TSS information
AT5G10690.1                      5'->3' (-)
Promoter sequence







 
AT5G10695.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G10690.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-3377454-122
TSS clone peakGclone-3377376-44

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCTCC-33774203377427-88-95
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCGACCCG-33774753377482-143-150
 AtREG539TCGACCCG PPDB Motif  PLACE Motif 
REGCAAGGCCCAAAT-33775143377525-182-193
 AtREG398CAAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353 AAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373   GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG421    GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGATATTGGGCTTTAA-33775373377550-205-218
 AtREG509ATATTGGG       PPDB Motif  PLACE Motif 
 AtREG355 TATTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG402  ATTGGGCT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   TTGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376    TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG365     GGGCTTTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG545      GGCTTTAA PPDB Motif  PLACE Motif 
REGAAAGTCAA-33775773377584-245-252
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 
REGCCGCGTTA-33777483377755-416-423
 AtREG488CCGCGTTASA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA5+3377749AT5G10695.1
TSS peakG5+3377752AT5G10695.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneCclone+3377753AT5G10695.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCTTATAAATA+33777153377725AT5G10695.1
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCGGGTCGA+33774753377482AT5G10695.1
 AtREG539CGGGTCGA PPDB Motif  PLACE Motif 
REGATTTGGGCCTTG+33775143377525AT5G10695.1
 AtREG421ATTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  TTGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353   TGGGCCTT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG398    GGGCCTTG PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTTAAAGCCCAATAT+33775373377550AT5G10695.1
 AtREG545TTAAAGCC       PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   AAGCCCAA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402    AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355     GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG509      CCCAATAT PPDB Motif  PLACE Motif 
REGTTGACTTT+33775773377584AT5G10695.1
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.