version
PlantPromoterDB promoter information of AT5G10695.1

Summary of Gene (AT5G10695.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G10695  TAIR      NCBI 
Gene model AT5G10695.1  
Description unknown protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 12 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G57123.1); Has 54 Blast hits to 54 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 54; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 3378767-3379966)

Genome position     
from initiation codon
AT5G10710.1         
AT5G10710.2         
TSS from cDNA
TSS information
AT5G10695.1                      5'->3' (+)
Promoter sequence








 
AT5G10700.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence








 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G10695.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA5+3377749-68
TSS peakG5+3377752-65

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+3377753-64

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCTTATAAATA+33777153377725-102-92
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGGGTCGA+33774753377482-342-335
 AtREG539CGGGTCGA PPDB Motif  PLACE Motif 
REGATTTGGGCCTTG+33775143377525-303-292
 AtREG421ATTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  TTGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353   TGGGCCTT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG398    GGGCCTTG PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTTAAAGCCCAATAT+33775373377550-280-267
 AtREG545TTAAAGCC       PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   AAGCCCAA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402    AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355     GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG509      CCCAATAT PPDB Motif  PLACE Motif 
REGTTGACTTT+33775773377584-240-233
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakC4-3378874AT5G10700.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+3379050AT5G10710.2, AT5G10710.1
TSS clone peakAclone+3379051AT5G10710.2, AT5G10710.1
TSS cloneCclone+3379080AT5G10710.2, AT5G10710.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCTCC-33788473378854AT5G10700.1
Y PatchCGTCTTCC-33788743378881AT5G10700.1
Y PatchCTCCTTTC+33790773379084AT5G10710.1, AT5G10710.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTAAAAGCCCATTAAG-33789143378928AT5G10700.1
 AtREG549TAAAAGCC        PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC       PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA      PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   AAGCCCAT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372    AGCCCATT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357     GCCCATTA   PPDB MotifGCCCA  PLACE Motif 
 AtREG396      CCCATTAA  PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG604       CCATTAAG PPDB Motif  PLACE MotifTTAATGG 
REGTGCCGTTTA-33789973379005AT5G10700.1
 AtREG500TGCCGTTT  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG613 GCCGTTTA PPDB MotifAAACG(C/G)  PLACE Motif 
REGACGGTTTAA-33791553379163AT5G10700.1
 AtREG652ACGGTTTA  PPDB Motif  PLACE Motif 
 AtREG473 CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAACGCTGCG+33788383378847AT5G10710.1, AT5G10710.2
 AtREG626AAACGCTG   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG369  ACGCTGCG PPDB Motif  PLACE Motif 
REGCTTAATGGGCTTTTA+33789143378928AT5G10710.1, AT5G10710.2
 AtREG604CTTAATGG        PPDB Motif  PLACE MotifTTAATGG 
 AtREG396 TTAATGGG       PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357  TAATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG372   AATGGGCT     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378    ATGGGCTT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376     TGGGCTTT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409      GGGCTTTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG549       GGCTTTTA PPDB Motif  PLACE Motif 
REGTAAACGGCA+33789973379005AT5G10710.1, AT5G10710.2
 AtREG613TAAACGGC  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG500 AAACGGCA PPDB MotifAAACG(C/G)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.