version
PlantPromoterDB promoter information of AT5G10730.1

Summary of Gene (AT5G10730.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G10730  TAIR      NCBI 
Gene model AT5G10730.1  
Description binding / catalytic/ coenzyme binding; FUNCTIONS IN: coenzyme binding, binding, catalytic activity; INVOLVED IN: cellular metabolic process, metabolic process; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: NAD-dependent epimerase/dehydratase (InterPro:IPR001509), NAD(P)-binding (InterPro:IPR016040); BEST Arabidopsis thaliana protein match is: dehydrogenase-related (TAIR:AT5G15910.1); Has 2817 Blast hits to 2817 proteins in 746 species: Archae - 59; Bacteria - 1671; Metazoa - 115; Fungi - 146; Plants - 119; Viruses - 0; Other Eukaryotes - 707 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 3393947-3392748)

Genome position     
from initiation codon
AT5G10740.1         
TSS from cDNA
TSS information
AT5G10730.1                      5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G10730.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-3393178-231
TSS clone peakGclone-3393106-159
TSS cloneAclone-3393042-95

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCGGGTCA-33931503393157-203-210
 AtREG617TCGGGTCA PPDB Motif  PLACE Motif 
REGCGTGGCTTCCCATGGG-33931673393182-220-235
 AtREG608CGTGGCTT        ABA PPDB Motif  PLACE MotifGCCAC 
 AtREG591        CCCATGGG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGAAGCCACG-33931923393199-245-252
 AtREG608AAGCCACGABA PPDB Motif  PLACE MotifGCCAC 
REGTTCGGCCCAATT-33932223393233-275-286
 AtREG427TTCGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG393 TCGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414  CGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352   GGCCCAAT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG418    GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGATAAGCCCAATTA-33932363393248-289-301
 AtREG462ATAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG426 TAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  AAGCCCAA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402   AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG418    GCCCAATT  PPDB MotifGCCCA  PLACE Motif 
 AtREG600     CCCAATTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.