version
PlantPromoterDB promoter information of AT5G11010.3

Summary of Gene (AT5G11010.3)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G11010  TAIR      NCBI 
Gene model AT5G11010.3  
Description pre-mRNA cleavage complex-related; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pre-mRNA cleavage complex II Clp1 (InterPro:IPR010655), NUC156 (InterPro:IPR012581); BEST Arabidopsis thaliana protein match is: CLPS3 (CLP-SIMILAR PROTEIN 3); binding (TAIR:AT3G04680.2); Has 423 Blast hits to 419 proteins in 168 species: Archae - 38; Bacteria - 4; Metazoa - 169; Fungi - 96; Plants - 49; Viruses - 0; Other Eukaryotes - 67 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 3483176-3484375)

Genome position     
from initiation codon
AT5G11010.1         
AT5G11010.2         
TSS from cDNA
TSS information
AT5G11010.3                      5'->3' (+)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G11010.3

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+3483742-434

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCCCTCT+34837433483750-433-426
Y PatchCTTCTCCTCT+34837723483781-404-395
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATTGCCAC+34834343483441-742-735
 AtREG654ATTGCCAC PPDB Motif  PLACE MotifGCCAC 
REGTGTCGTTTC+34834543483462-722-714
 AtREG569TGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG576 GTCGTTTC PPDB Motif  PLACE Motif 
REGTTTCCGGTTCG+34836073483617-569-559
 AtREG644TTTCCGGT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534 TTCCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579  TCCGGTTC  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423   CCGGTTCG PPDB MotifAACCG(G/A)  PLACE Motif 
REGACCGGTTTT+34836453483653-531-523
 AtREG436ACCGGTTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG542 CCGGTTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTCCGGTTCGGTTT+34836883483701-488-475
 AtREG534TTCCGGTT       PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579 TCCGGTTC      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423  CCGGTTCG     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG456   CGGTTCGG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451    GGTTCGGT   PPDB Motif  PLACE Motif 
 AtREG556     GTTCGGTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568      TTCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.