version
PlantPromoterDB promoter information of AT5G11070.1

Summary of Gene (AT5G11070.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G11070  TAIR      NCBI 
Gene model AT5G11070.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G35090.1); Has 22 Blast hits to 22 proteins in 3 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 22; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 3517898-3516699)

Genome position     
from initiation codon
AT5G11080.1         
TSS from cDNA
TSS information
AT5G11070.1                      5'->3' (-)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G11070.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4-3516925-27

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-3516995-97
TSS cloneCclone-3516994-96
TSS cloneGclone-3516991-93
TSS cloneTclone-3516990-92

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCAGGCCCAAAAGCCCAC-35170853517102-187-204
 AtREG374TCAGGCCC           PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG370 CAGGCCCA          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  AGGCCCAA         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373   GGCCCAAA        PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG529    GCCCAAAA       PPDB MotifGCCCA  PLACE Motif 
 AtREG409        AAAAGCCC   PPDB MotifGCCCA  PLACE Motif 
 AtREG376         AAAGCCCA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG518          AAGCCCAC PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGAAAACGCG-35171053517112-207-214
 AtREG566AAAACGCG PPDB MotifAAACG(C/G)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.