version
PlantPromoterDB promoter information of AT5G13030.1

Summary of Gene (AT5G13030.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G13030  TAIR      NCBI 
Gene model AT5G13030.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Uncharacterised protein family UPF0061 (InterPro:IPR003846); Has 4055 Blast hits to 4018 proteins in 759 species: Archae - 4; Bacteria - 1451; Metazoa - 102; Fungi - 81; Plants - 27; Viruses - 0; Other Eukaryotes - 2390 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 4132216-4133415)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G13030.1                      5'->3' (+)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence


 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G13030.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA5+4133195-21

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+4133210-6

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATAAACCGA+41330944133102-122-114
 AtREG598ATAAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTGAACCGGAAAAGTCAA+41331194133135-97-81
 AtREG480TGAACCGG          PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579 GAACCGGA         PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534  AACCGGAA        PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG644   ACCGGAAA       PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG632         AAAGTCAA PPDB Motif  PLACE MotifTTGAC 
REGTCGGTTCGGT+41331424133151-74-65
 AtREG575TCGGTTCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG456 CGGTTCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451  GGTTCGGT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG4-4132755AT5G13020.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGAAACGACA-41328814132889AT5G13020.1
 AtREG576GAAACGAC  PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.