version
PlantPromoterDB promoter information of AT5G15410.1

Summary of Gene (AT5G15410.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G15410  TAIR      NCBI 
Gene model AT5G15410.1  
Description 'defense, no death' gene (DND1) encodes a mutated cyclic nucleotide-gated cation channel; Same as CNGC2 (article ID 229): Cyclic nucleotide gated channel, activated by cAMP, conducts K+ and other monovalent cations but excludes Na+, does not contain the GYG amino acid sequence found in other channels with this conductivity profile. Conducts Ca2+ into cells which is linked to the generation of NO and the NO signaling pathway involved in the innate immune response to pathogens.  
#
#

Overview

Focused view (chromosome 5: 5006013-5004814)

Genome position     
from initiation codon
AT5G15410.2         
TSS from cDNA
TSS information
AT5G15410.1                      5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G15410.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG27-5006811-48

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-5006900-137
TSS cloneGclone-5006880-117
TSS cloneCclone-5006814-51
TSS cloneCclone-5006813-50
TSS cloneTclone-5006812-49
TSS cloneGclone-5006811-48
TSS cloneCclone-5006810-47
TSS cloneAclone-5006809-46

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCTCTATA-50068445006851-81-88
Y PatchTTTCTTCTCTCCCTCTCC-50067885006805-25-42
Y PatchCTCTTCTCTCTCCC-50068235006836-60-73
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATAAACCGAA-50068995006908-136-145
 AtREG598ATAAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTAAACCGGAA-50069225006932-159-169
 AtREG473TTAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521  AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534   AACCGGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCCGGTTCGGTTT-50069635006974-200-211
 AtREG423CCGGTTCG     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG456 CGGTTCGG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451  GGTTCGGT   PPDB Motif  PLACE Motif 
 AtREG556   GTTCGGTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568    TTCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTGTGGGCCGTTTT-50070365007048-273-285
 AtREG612TGTGGGCC     DREB1Aox PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG368  TGGGCCGT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG377   GGGCCGTT   PPDB MotifGCCCA, AAACG(C/G)  PLACE MotifGGGCC 
 AtREG531     GCCGTTTT PPDB MotifAAACG(C/G)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.