version
PlantPromoterDB promoter information of AT5G15850

Summary of Gene (AT5G15850)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G15850  TAIR      NCBI 
Gene model AT5G15850  
Description Homologous to the flowering-time gene CONSTANS.  
#
#

Overview

Focused view (chromosome 5: 5178473-5177274)

Genome position     
from initiation codon
AT5G15845.1         
AT5G15850.1         
TSS from cDNA
TSS information
AT5G15850                        5'->3' (-)
Promoter sequence






 
AT5G15845           
AT5G15845.1         
AT5G15853.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G15850

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13-5177519-46

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-5177519-46
TSS cloneCclone-5177516-43
TSS cloneAclone-5177509-36

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCGCCACGTGTCC-51775985177610-125-137
 AtREG471TCGCCACG     ABA PPDB Motif  PLACE MotifGCCAC 
 AtREG371 CGCCACGT    ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG367  GCCACGTG   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG382   CCACGTGT  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG366    CACGTGTC ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACGTGKC, ACACNNG, ACGTGTC 
 AtREG472     ACGTGTCCABA, DREB1Aox, Drought PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.