version
PlantPromoterDB promoter information of AT5G15960

Summary of Gene (AT5G15960)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G15960  TAIR      NCBI 
Gene model AT5G15960  
Description cold and ABA inducible protein kin1, possibly functions as an anti-freeze protein. Transcript level of this gene is induced by cold, ABA, dehydration and osmoticum (mannitol). However, protein activity of GUS fused to the promoter of this gene is inhibited by cold treatment, suggesting an inhibition of the protein by increased transcript level.  
#
#

Overview

Focused view (chromosome 5: 5210092-5211291)

Genome position     
from initiation codon
AT5G15960.1         
TSS from cDNA
TSS information
AT5G15960                        5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G15960

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA31+5209932-60

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+5209932-60
TSS cloneTclone+5209933-59
TSS cloneTclone+5209936-56

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxGCCTATAAATATAAACC+52098945209910-98-82
Y PatchTCTCTTCTC+52099235209931-69-61
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAACGACACGTGA+52097745209787-218-205
 AtREG520AAAACGAC       PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA      PPDB Motif  PLACE Motif 
 AtREG527  AACGACAC    DREB1Aox PPDB Motif  PLACE Motif 
 AtREG428   ACGACACG   ABA, DREB1Aox, Ethylene, Drought PPDB Motif  PLACE Motif 
 AtREG478    CGACACGT  ABA, DREB1Aox, Drought PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG366     GACACGTG ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACGTGKC, ACACNNG, ACGTGTC 
 AtREG628      ACACGTGADREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
REGATCCACGTGGT+52098515209861-141-131
 AtREG547ATCCACGT   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG408 TCCACGTG  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG544   CACGTGGTABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGCGTGGCAC+52098735209880-119-112
 AtREG444CGTGGCAC PPDB Motif  PLACE MotifGCCAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.