version
PlantPromoterDB promoter information of AT5G16130

Summary of Gene (AT5G16130)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G16130  TAIR      NCBI 
Gene model AT5G16130  
Description 40S ribosomal protein S7 (RPS7C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, cytosolic ribosome, nucleolus, plasma membrane, membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S7e (InterPro:IPR000554); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S7 (RPS7B) (TAIR:AT3G02560.2); Has 554 Blast hits to 554 proteins in 221 species: Archae - 0; Bacteria - 0; Metazoa - 253; Fungi - 94; Plants - 107; Viruses - 0; Other Eukaryotes - 100 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 5271934-5273133)

Genome position     
from initiation codon
AT5G16150.1         
AT5G16150.2         
AT5G16150.3         
TSS from cDNA
TSS information
AT5G16130                        5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G16130

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG119+5268460-524

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+5268437-547
TSS cloneGclone+5268438-546
TSS cloneAclone+5268439-545
TSS cloneGclone+5268460-524
TSS cloneAclone+5268461-523
TSS cloneAclone+5268462-522
TSS cloneGclone+5268463-521
TSS cloneGclone+5268464-520

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTTCTTC+52684985268506-486-478
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATGGGCTTA+52683415268349-643-635
 AtREG378ATGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426 TGGGCTTA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGGGGCTTTAA+52683515268359-633-625
 AtREG365GGGCTTTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG545 GGCTTTAA PPDB Motif  PLACE Motif 
REGTTTAACGGCCCATAT+52683665268380-618-604
 AtREG610TTTAACGG        PPDB Motif  PLACE MotifYAACKG, CNGTTR 
 AtREG377   AACGGCCC     PPDB MotifGCCCA, AAACG(C/G)  PLACE MotifGGGCC 
 AtREG368    ACGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380     CGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG364      GGCCCATA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG432       GCCCATAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA17+5272580AT5G16150.1, AT5G16150.2, AT5G16150.3

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+5272557AT5G16150.1, AT5G16150.2, AT5G16150.3
TSS cloneAclone+5272584AT5G16150.1, AT5G16150.2, AT5G16150.3
TSS cloneAclone+5272589AT5G16150.1, AT5G16150.2, AT5G16150.3

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTTCTC+52725725272579AT5G16150.1, AT5G16150.2, AT5G16150.3
Y PatchTCCTCTCTCTC+52726155272625AT5G16150.1, AT5G16150.2, AT5G16150.3
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTAAGCCCATTAA-52719795271990AT5G16140.1, AT5G16140.2
 AtREG426TAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372  AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357   GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG396    CCCATTAA PPDB MotifGCCCA  PLACE MotifTTAATGG 
REGTGGGCTAA-52719975272004AT5G16140.1, AT5G16140.2
 AtREG571TGGGCTAA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGCTTGGGCCAC-52720285272037AT5G16140.1, AT5G16140.2
 AtREG505CTTGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420 TTGGGCCA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG445  TGGGCCAC PPDB MotifGCCCA  PLACE MotifGCCAC, GGGCC, TGGGCY 
REGGCGTTTTA+52725275272534AT5G16150.1, AT5G16150.2, AT5G16150.3
 AtREG564GCGTTTTA PPDB MotifAAACG(C/G)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.