version
PlantPromoterDB promoter information of AT5G16150.2

Summary of Gene (AT5G16150.2)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G16150  TAIR      NCBI 
Gene model AT5G16150.2  
Description Encodes a putative plastidic glucose transporter.  
#
#

Overview

Focused view (chromosome 5: 5271904-5273103)

Genome position     
from initiation codon
AT5G16150.1         
AT5G16150.3         
TSS from cDNA
TSS information
AT5G16150.2                      5'->3' (+)
Promoter sequence




 
AT5G16140.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G16150.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA17+5272580-324

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+5272557-347
TSS cloneAclone+5272584-320
TSS cloneAclone+5272589-315

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTTCTC+52725725272579-332-325
Y PatchTCCTCTCTCTC+52726155272625-289-279
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCGTTTTA+52725275272534-377-370
 AtREG564GCGTTTTA PPDB MotifAAACG(C/G)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTAAGCCCATTAA-52719795271990AT5G16140.1, AT5G16140.2
 AtREG426TAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372  AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG357   GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG396    CCCATTAA PPDB MotifGCCCA  PLACE MotifTTAATGG 
REGTGGGCTAA-52719975272004AT5G16140.1, AT5G16140.2
 AtREG571TGGGCTAA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGCTTGGGCCAC-52720285272037AT5G16140.1, AT5G16140.2
 AtREG505CTTGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420 TTGGGCCA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG445  TGGGCCAC PPDB MotifGCCCA  PLACE MotifGCCAC, GGGCC, TGGGCY 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.