version
PlantPromoterDB promoter information of AT5G16830.1

Summary of Gene (AT5G16830.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G16830  TAIR      NCBI 
Gene model AT5G16830.1  
Description member of SYP2 Gene Family. Over-expression of the gene in tobacco protoplasts leads to a disruption of vacuolar transport from the prevacuolar compartment (PVC) to the vacuole, but not from the Golgi apparatus to the plasma membrane.  
#
#

Overview

Focused view (chromosome 5: 5536152-5534953)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G16830.1                      5'->3' (-)
Promoter sequence





 
AT5G16840.1         
AT5G16840.2         
AT5G16840.3         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G16830.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG17-5535214-62

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-5535267-115
TSS cloneGclone-5535214-62
TSS cloneTclone-5535213-61

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTCACGCGG-55353145535322-162-170
 AtREG631TTCACGCG Drought PPDB Motif  PLACE Motif 
 AtREG502 TCACGCGGDrought PPDB Motif  PLACE Motif 
REGCGTGTCAC-55353685535375-216-223
 AtREG498CGTGTCACABA PPDB Motif  PLACE Motif 
REGAACGACACG-55353985535406-246-254
 AtREG527AACGACAC DREB1Aox PPDB Motif  PLACE Motif 
 AtREG428 ACGACACGABA, DREB1Aox, Ethylene, Drought PPDB Motif  PLACE Motif 
REGCGAACCGA-55354435535450-291-298
 AtREG575CGAACCGA PPDB MotifAACCG(G/A)  PLACE Motif 
REGGTCCGGTTTAC-55354525535462-300-310
 AtREG573GTCCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412  CCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG519   CGGTTTAC PPDB MotifAACCG(G/A)  PLACE Motif 
REGAGCCCAAAA-55355025535510-350-358
 AtREG469AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG529 GCCCAAAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA5+5535924AT5G16840.1, AT5G16840.2, AT5G16840.3

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+5535895AT5G16840.1, AT5G16840.2, AT5G16840.3
TSS cloneTclone+5535921AT5G16840.1, AT5G16840.2, AT5G16840.3
TSS cloneAclone+5535924AT5G16840.1, AT5G16840.2, AT5G16840.3
TSS cloneTclone+5535925AT5G16840.1, AT5G16840.2, AT5G16840.3

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxCATATAAAGC+55358895535898AT5G16840.1, AT5G16840.2, AT5G16840.3
Y PatchCTTCCCTCTCT+55359095535919AT5G16840.1, AT5G16840.2, AT5G16840.3
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.