version
PlantPromoterDB promoter information of AT5G18390.1

Summary of Gene (AT5G18390.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G18390  TAIR      NCBI 
Gene model AT5G18390.1  
Description pentatricopeptide (PPR) repeat-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT5G65820.1); Has 14680 Blast hits to 4971 proteins in 159 species: Archae - 2; Bacteria - 2; Metazoa - 244; Fungi - 162; Plants - 13880; Viruses - 0; Other Eukaryotes - 390 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 6089954-6091153)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G18390.1                      5'->3' (+)
Promoter sequence



 
AT5G18380.1         
AT5G18380.2         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G18390.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakC2+6090943-11

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTCT+60909076090914-47-40
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAGGGCTTTAT+60907796090789-175-165
 AtREG651TAGGGCTT    PPDB Motif  PLACE Motif 
 AtREG365  GGGCTTTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG601   GGCTTTAT PPDB Motif  PLACE Motif 
REGCGCAGCGTTTTA+60908246090835-130-119
 AtREG369CGCAGCGT     PPDB Motif  PLACE Motif 
 AtREG626  CAGCGTTT   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG564    GCGTTTTA PPDB MotifAAACG(C/G)  PLACE Motif 
REGTTCCACGTCAC+60908816090891-73-63
 AtREG627TTCCACGT    PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG419  CCACGTCA  PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG466   CACGTCACABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA204-6090758AT5G18380.1, AT5G18380.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-6090804AT5G18380.1, AT5G18380.2
TSS cloneCclone-6090760AT5G18380.1, AT5G18380.2
TSS cloneAclone-6090758AT5G18380.1, AT5G18380.2
TSS cloneCclone-6090757AT5G18380.1, AT5G18380.2
TSS cloneTclone-6090756AT5G18380.1, AT5G18380.2
TSS cloneCclone-6090755AT5G18380.1, AT5G18380.2
TSS cloneTclone-6090754AT5G18380.1, AT5G18380.2
TSS cloneTclone-6090752AT5G18380.1, AT5G18380.2
TSS cloneGclone-6090745AT5G18380.1, AT5G18380.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxAATATAAAGCCCTATAT-60907766090792AT5G18380.1, AT5G18380.2
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTAAAACGCTGCG-60908246090835AT5G18380.1, AT5G18380.2
 AtREG564TAAAACGC     PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG626  AAACGCTG   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG369    ACGCTGCG PPDB Motif  PLACE Motif 
REGGTGACGTGGAA-60908816090891AT5G18380.1, AT5G18380.2
 AtREG466GTGACGTG   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG419 TGACGTGG   PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG627   ACGTGGAA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGAACGACGA-60909656090972AT5G18380.1, AT5G18380.2
 AtREG648AACGACGA PPDB Motif  PLACE Motif 
REGAAATGACG-60910326091039AT5G18380.1, AT5G18380.2
 AtREG657AAATGACG PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.