version
PlantPromoterDB promoter information of AT5G18630

Summary of Gene (AT5G18630)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G18630  TAIR      NCBI 
Gene model AT5G18630  
Description lipase class 3 family protein; FUNCTIONS IN: triacylglycerol lipase activity; INVOLVED IN: lipid metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Lipase, class 3 (InterPro:IPR002921); BEST Arabidopsis thaliana protein match is: lipase class 3 family protein (TAIR:AT5G18640.1); Has 1391 Blast hits to 1388 proteins in 240 species: Archae - 0; Bacteria - 253; Metazoa - 123; Fungi - 335; Plants - 341; Viruses - 9; Other Eukaryotes - 330 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 6201965-6203164)

Genome position     
from initiation codon
AT5G18630.1         
AT5G18630.2         
AT5G18630.3         
TSS from cDNA
TSS information
AT5G18630                        5'->3' (+)
Promoter sequence











 
AT5G18620.1         
AT5G18620.2         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence











 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G18630

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA5+6202612-353

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+6202641-324
TSS cloneTclone+6202654-311
TSS cloneGclone+6202680-285
TSS cloneGclone+6202681-284

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTTCT+62026016202608-364-357
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGCTTTAAAGGCCCATGGGC+62023196202339-646-626
 AtREG365GGGCTTTA              PPDB MotifGCCCA  PLACE Motif 
 AtREG545 GGCTTTAA             PPDB Motif  PLACE Motif 
 AtREG639     TTAAAGGC         PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG467      TAAAGGCC        PPDB Motif  PLACE Motif 
 AtREG359       AAAGGCCC       PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353        AAGGCCCA      PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354         AGGCCCAT     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG504          GGCCCATG    PPDB MotifGCCCA, CCATGG  PLACE MotifGGGCC, TGGGCY 
 AtREG591            CCCATGGG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 AtREG507           GCCCATGGGC PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGAAAGTCAA+62023656202372-600-593
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 
REGGGCCTTAT+62024046202411-561-554
 AtREG425GGCCTTAT PPDB MotifAACCG(G/A)  PLACE Motif 
REGAATACCCTT+62024896202497-476-468
 AtREG567AATACCCT  PPDB MotifACCCT  PLACE Motif 
 AtREG623 ATACCCTT PPDB MotifACCCT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakTclone-6202166AT5G18620.1, AT5G18620.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGACGTGGCAC-62022406202248AT5G18620.1, AT5G18620.2
 AtREG379ACGTGGCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG444 CGTGGCAC PPDB Motif  PLACE MotifGCCAC 
REGGCCCATGGGCCTTTAAAGCCC-62023196202339AT5G18620.1, AT5G18620.2
 AtREG591 CCCATGGG             PPDB MotifGCCCA, CCATGG  PLACE Motif 
 AtREG507GCCCATGGGC            PPDB MotifGCCCA, CCATGG  PLACE Motif 
 AtREG504   CATGGGCC           PPDB MotifGCCCA, CCATGG  PLACE MotifGGGCC, TGGGCY 
 AtREG354    ATGGGCCT          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353     TGGGCCTT         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG359      GGGCCTTT        PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG467       GGCCTTTA       PPDB Motif  PLACE Motif 
 AtREG639        GCCTTTAA      PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG545            TTAAAGCC  PPDB Motif  PLACE Motif 
 AtREG365             TAAAGCCC PPDB MotifGCCCA  PLACE Motif 
REGTTGACTTT-62023656202372AT5G18620.1, AT5G18620.2
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 
REGATAAGGCC-62024046202411AT5G18620.1, AT5G18620.2
 AtREG425ATAAGGCC PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.