version
PlantPromoterDB promoter information of AT5G19140.1

Summary of Gene (AT5G19140.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G19140  TAIR      NCBI 
Gene model AT5G19140.1  
Description AILP1; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to aluminum ion, response to auxin stimulus; LOCATED IN: plasma membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G43830.1); Has 1128 Blast hits to 1128 proteins in 380 species: Archae - 4; Bacteria - 553; Metazoa - 42; Fungi - 34; Plants - 256; Viruses - 3; Other Eukaryotes - 236 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 6422398-6423597)

Genome position     
from initiation codon
AT5G19140.2         
TSS from cDNA
TSS information
AT5G19140.1                      5'->3' (+)
Promoter sequence






 
AT5G19150.2         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G19140.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG74+6423273-125

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+6423153-245
TSS cloneCclone+6423268-130
TSS cloneCclone+6423269-129
TSS cloneGclone+6423273-125
TSS cloneTclone+6423274-124
TSS cloneCclone+6423275-123
TSS cloneCclone+6423277-121
TSS cloneTclone+6423279-119
TSS cloneAclone+6423285-113
TSS cloneTclone+6423286-112

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTTCCTATAT+64232336423241-165-157
Y PatchCATCTCTCTCTCCT+64232576423270-141-128
Y PatchCGTCTTCC+64232776423284-121-114
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGTCCCAC+64230386423045-360-353
 AtREG406GGTCCCAC PPDB MotifGGGACCC  PLACE Motif 
REGGATGACGT+64231276423134-271-264
 AtREG578GATGACGTABA PPDB MotifACGT  PLACE MotifACGT 
REGAAATGACG+64231976423204-201-194
 AtREG657AAATGACG PPDB Motif  PLACE Motif 
REGAAATACCCT+64232066423214-192-184
 AtREG602AAATACCC  PPDB Motif  PLACE Motif 
 AtREG567 AATACCCT PPDB MotifACCCT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.