version
PlantPromoterDB promoter information of AT5G19180.1

Summary of Gene (AT5G19180.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G19180  TAIR      NCBI 
Gene model AT5G19180.1  
Description Encodes a subunit of a RUB-activating enzyme analogous to the E1 ubiquitin-activating enzyme. ECR1 functions as a heterodimer with AXR1 to activate RUB, a ubiquitin-related protein.  
#
#

Overview

Focused view (chromosome 5: 6452375-6453574)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G19180.1                      5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G19180.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4+6453300-75

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+6453276-99
TSS cloneAclone+6453277-98
TSS cloneGclone+6453311-64
TSS cloneCclone+6453312-63

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCC+64533236453330-52-45
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTTGGGCCTAGCCCAGTA+64532126453230-163-145
 AtREG529TTTTGGGC            PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  TTGGGCCT          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358   TGGGCCTA         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG475    GGGCCTAG        PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG434           GCCCAGTA PPDB MotifGCCCA  PLACE Motif 
REGCCCAATAA+64532356453242-140-133
 AtREG417CCCAATAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.