version
PlantPromoterDB promoter information of AT5G19930.1

Summary of Gene (AT5G19930.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G19930  TAIR      NCBI 
Gene model AT5G19930.1  
Description integral membrane family protein; LOCATED IN: endomembrane system; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF92, transmembrane (InterPro:IPR002794); Has 682 Blast hits to 682 proteins in 225 species: Archae - 93; Bacteria - 179; Metazoa - 99; Fungi - 48; Plants - 47; Viruses - 0; Other Eukaryotes - 216 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 6740283-6739084)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G19930.1                      5'->3' (-)
Promoter sequence







 
AT5G19940.1         
AT5G19940.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G19930.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-6739348-65
TSS clone peakAclone-6739347-64
TSS cloneCclone-6739292-9

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCTCTCC-67393366739343-53-60
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTATTGGGTCAGCCCATTTGAGGCCCATG-67394306739458-147-175
 AtREG624CTATTGGG                      PPDB MotifGCCCA  PLACE Motif 
 AtREG609        TCAGCCCA              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372          AGCCCATT            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG386           GCCCATTT           PPDB MotifGCCCA  PLACE Motif 
 AtREG587                  TGAGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG447                   GAGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354                    AGGCCCAT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG504                     GGCCCATG PPDB MotifGCCCA, CCATGG  PLACE MotifGGGCC, TGGGCY 
REGATGGCCCA-67395026739509-219-226
 AtREG437ATGGCCCA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGCCGCGTTA-67395416739548-258-265
 AtREG488CCGCGTTASA PPDB Motif  PLACE Motif 
REGGGGCCCATA-67395746739582-291-299
 AtREG391GGGCCCAT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG364 GGCCCATA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGGTGCCACGTCAT-67396006739611-317-328
 AtREG444GTGCCACG     PPDB Motif  PLACE MotifGCCAC 
 AtREG379 TGCCACGT   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG388  GCCACGTC   PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG419   CCACGTCA  PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG483    CACGTCAT PPDB MotifACGT  PLACE MotifACGT, ACGTG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA17+6739689AT5G19940.1, AT5G19940.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone+6739634AT5G19940.1, AT5G19940.2
TSS cloneTclone+6739645AT5G19940.1, AT5G19940.2
TSS cloneCclone+6739649AT5G19940.1, AT5G19940.2
TSS cloneTclone+6739651AT5G19940.1, AT5G19940.2
TSS cloneCclone+6739654AT5G19940.1, AT5G19940.2
TSS cloneTclone+6739655AT5G19940.1, AT5G19940.2
TSS cloneTclone+6739657AT5G19940.1, AT5G19940.2
TSS cloneAclone+6739661AT5G19940.1, AT5G19940.2
TSS cloneAclone+6739684AT5G19940.1, AT5G19940.2
TSS cloneAclone+6739690AT5G19940.1, AT5G19940.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCTCCC+67396406739650AT5G19940.1, AT5G19940.2
Y PatchCTTCTCTCTCTT+67396636739674AT5G19940.1, AT5G19940.2
Y PatchCTCTCTCC+67396766739683AT5G19940.1, AT5G19940.2
Y PatchCTTCTTCTCTT+67397066739716AT5G19940.1, AT5G19940.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCATGGGCCTCAAATGGGCTGACCCAATAG+67394306739458AT5G19940.1, AT5G19940.2
 AtREG504CATGGGCC                      PPDB MotifGCCCA, CCATGG  PLACE MotifGGGCC, TGGGCY 
 AtREG354 ATGGGCCT                     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG447  TGGGCCTC                    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG587   GGGCCTCA                   PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG386          AAATGGGC            PPDB MotifGCCCA  PLACE Motif 
 AtREG372           AATGGGCT           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG609             TGGGCTGA         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG624                     CCCAATAG PPDB MotifGCCCA  PLACE Motif 
REGTGGGCCAT+67395026739509AT5G19940.1, AT5G19940.2
 AtREG437TGGGCCAT PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGTAACGCGG+67395416739548AT5G19940.1, AT5G19940.2
 AtREG488TAACGCGGSA PPDB Motif  PLACE Motif 
REGTATGGGCCC+67395746739582AT5G19940.1, AT5G19940.2
 AtREG364TATGGGCC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG391 ATGGGCCC PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGATGACGTGGCAC+67396006739611AT5G19940.1, AT5G19940.2
 AtREG483ATGACGTG     PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG419 TGACGTGG    PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG388  GACGTGGC   PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG379   ACGTGGCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG444    CGTGGCAC PPDB Motif  PLACE MotifGCCAC 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.