version
PlantPromoterDB promoter information of AT5G19950

Summary of Gene (AT5G19950)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G19950  TAIR      NCBI 
Gene model AT5G19950  
Description unknown protein; LOCATED IN: mitochondrion; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Region of unknown function DUF1767 (InterPro:IPR013894); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G63540.2); Has 462 Blast hits to 405 proteins in 107 species: Archae - 0; Bacteria - 22; Metazoa - 231; Fungi - 48; Plants - 71; Viruses - 3; Other Eukaryotes - 87 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 6741302-6740103)

Genome position     
from initiation codon
AT5G19950.1         
AT5G19950.2         
AT5G19950.3         
TSS from cDNA
TSS information
AT5G19950                        5'->3' (-)
Promoter sequence

 
AT5G19940.1         
AT5G19940.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G19950

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-6743773-71

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTTCC-67437376743744-35-42
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCAAAACG-67438326743839-130-137
 AtREG653TCAAAACG PPDB MotifAAACG(C/G)  PLACE Motif 
REGAAACCGGAAA-67439106743919-208-217
 AtREG521AAACCGGA   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534 AACCGGAA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG644  ACCGGAAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGATATGGGCCATTAGGCCCACTA-67439256743946-223-244
 AtREG432ATATGGGC               PPDB MotifGCCCA  PLACE Motif 
 AtREG364 TATGGGCC              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490  ATGGGCCA             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG437   TGGGCCAT            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG506         ATTAGGCC      PPDB Motif  PLACE Motif 
 AtREG360          TTAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358           TAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG482            AGGCCCAC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG532              GCCCACTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.