version
PlantPromoterDB promoter information of AT5G20570.2

Summary of Gene (AT5G20570.2)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G20570  TAIR      NCBI 
Gene model AT5G20570.2  
Description Encodes a ring-box 1 like protein and component of the SCF ubiquitinization complex mediating auxin responses. Forms a E3 ubiquitin ligase complex with CUL3A and At1g21780.1 a BTB domain protein.  
#
#

Overview

Focused view (chromosome 5: 6959221-6958022)

Genome position     
from initiation codon
AT5G20570.1         
AT5G20570.3         
AT5G20580.1         
AT5G20580.2         
TSS from cDNA
TSS information
AT5G20570.2                      5'->3' (-)
Promoter sequence














 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G20570.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA46-6958304-83

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-6958309-88
TSS cloneCclone-6958308-87
TSS cloneTclone-6958307-86
TSS cloneAclone-6958302-81
TSS cloneAclone-6958301-80

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTTTATATATCT-69583346958345-113-124
Y PatchTCTCTCTCT-69583056958313-84-92
Y PatchTCTCTCTTCTTCTTCCTCT-69583186958336-97-115
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAAAGCCCAAA-69583506958360-129-139
 AtREG559CAAAGCCC    PPDB MotifGCCCA  PLACE Motif 
 AtREG376 AAAGCCCA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  AAGCCCAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469   AGCCCAAA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGAAAGCCCACTA-69583676958377-146-156
 AtREG376AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG518 AAGCCCAC   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG510  AGCCCACT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG532   GCCCACTA PPDB MotifGCCCA  PLACE Motif 
REGTTAAACCGAA-69584106958419-189-198
 AtREG473TTAAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.