version
PlantPromoterDB promoter information of AT5G22360.1

Summary of Gene (AT5G22360.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G22360  TAIR      NCBI 
Gene model AT5G22360.1  
Description Member of Synaptobrevin-like AtVAMP7C, v-SNARE protein family.  
#
#

Overview

Focused view (chromosome 5: 7406654-7405455)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G22360.1                      5'->3' (-)
Promoter sequence







 
AT5G22370.1         
AT5G22370.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G22360.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG15-7405728-74

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-7405765-111
TSS cloneAclone-7405758-104
TSS cloneAclone-7405745-91
TSS cloneGclone-7405739-85

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTAAACCGTAAACCGA-74058767405891-222-237
 AtREG519GTAAACCGTAAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG652 TAAACCGT        PPDB Motif  PLACE Motif 
 AtREG514        TAAACCGA PPDB MotifAACCG(G/A)  PLACE Motif 
REGGGCCTAAT-74058987405905-244-251
 AtREG506GGCCTAAT PPDB Motif  PLACE Motif 
REGTTCGGGTCGG-74059297405938-275-284
 AtREG597TTCGGGTC   PPDB MotifGGGACCC  PLACE Motif 
 AtREG383 TCGGGTCG  PPDB Motif  PLACE Motif 
 AtREG375  CGGGTCGG PPDB MotifCCGAC  PLACE MotifCCGAC 
REGCCAAACCGAA-74059477405956-293-302
 AtREG550CCAAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCGAACCGAACCGGAT-74060097406023-355-369
 AtREG575CGAACCGA        PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556  AACCGAAC      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451   ACCGAACC     PPDB Motif  PLACE Motif 
 AtREG456    CCGAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423     CGAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579      GAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561       AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.