version
PlantPromoterDB promoter information of AT5G24314.1

Summary of Gene (AT5G24314.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G24314  TAIR      NCBI 
Gene model AT5G24314.1  
Description PTAC7; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plastid chromosome, nucleoid; Has 35 Blast hits to 35 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 35; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 8276750-8277949)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G24314.1                      5'->3' (+)
Promoter sequence







 
AT5G24313.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence








 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G24314.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8+8277739-11

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+8277742-8
TSS cloneTclone+8277745-5
TSS cloneTclone+8277747-3

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCATATAAAAT+82777088277717-42-33
Y PatchCTTCCTTC+82777548277761411
Y PatchTTCTTCTCC+827776782777751725
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAATGACG+82776098277616-141-134
 AtREG657AAATGACG PPDB Motif  PLACE Motif 
REGCCGGTTCGGTT+82776318277641-119-109
 AtREG423CCGGTTCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG456 CGGTTCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451  GGTTCGGT  PPDB Motif  PLACE Motif 
 AtREG556   GTTCGGTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTAAACCGAACCGG+82776858277698-65-52
 AtREG473TTAAACCG       PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556   AACCGAAC    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451    ACCGAACC   PPDB Motif  PLACE Motif 
 AtREG456     CCGAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423      CGAACCGG PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone-8277402AT5G24313.1
TSS clone peakTclone-8277370AT5G24313.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxTGTATATACA-82774278277436AT5G24313.1
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCGTCATTT-82776098277616AT5G24313.1
 AtREG657CGTCATTT PPDB Motif  PLACE Motif 
REGAACCGAACCGG-82776318277641AT5G24313.1
 AtREG556AACCGAAC    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451 ACCGAACC   PPDB Motif  PLACE Motif 
 AtREG456  CCGAACCG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423   CGAACCGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGTCCGGTTCGGTTTAA-82776858277699AT5G24313.1
 AtREG579TCCGGTTC        PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423 CCGGTTCG       PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG456  CGGTTCGG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451   GGTTCGGT     PPDB Motif  PLACE Motif 
 AtREG556    GTTCGGTT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568     TTCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514      TCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473       CGGTTTAA PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.