version
PlantPromoterDB promoter information of AT5G25070

Summary of Gene (AT5G25070)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G25070  TAIR      NCBI 
Gene model AT5G25070  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 81684 Blast hits to 44791 proteins in 1880 species: Archae - 1252; Bacteria - 11295; Metazoa - 39436; Fungi - 6166; Plants - 3117; Viruses - 367; Other Eukaryotes - 20051 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 8644471-8643272)

Genome position     
from initiation codon
AT5G25070.1         
TSS from cDNA
TSS information
AT5G25070                        5'->3' (-)
Promoter sequence










 
AT5G25080.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence










 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G25070

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8-8643504-33

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-8643491-20

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTAAGGCCCATTAA-86435558643568-84-97
 AtREG416TTAAGGCC       PPDB Motif  PLACE Motif 
 AtREG351 TAAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353  AAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354   AGGCCCAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361    GGCCCATT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357     GCCCATTA  PPDB MotifGCCCA  PLACE Motif 
 AtREG396      CCCATTAA PPDB MotifGCCCA  PLACE MotifTTAATGG 
REGATATGGGCCGTTAATAGGCCCAAG-86435828643605-111-134
 AtREG432ATATGGGC                 PPDB MotifGCCCA  PLACE Motif 
 AtREG364 TATGGGCC                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380  ATGGGCCG               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG368   TGGGCCGT              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG377    GGGCCGTT             PPDB MotifGCCCA, AAACG(C/G)  PLACE MotifGGGCC 
 AtREG424            AATAGGCC     PPDB Motif  PLACE Motif 
 AtREG362             ATAGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358              TAGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356               AGGCCCAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG505                GGCCCAAG PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGACGTCAGC-86436148643621-143-150
 AtREG515ACGTCAGCSA PPDB MotifACGT  PLACE MotifACGT 
REGTTTCCGGTTA-86437028643711-231-240
 AtREG644TTTCCGGT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534 TTCCGGTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG621  TCCGGTTA PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG5+8643707AT5G25080.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone+8643684AT5G25080.1
TSS cloneGclone+8643697AT5G25080.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTAATGGGCCTTAA+86435558643568AT5G25080.1
 AtREG396TTAATGGG       PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357 TAATGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG361  AATGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354   ATGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353    TGGGCCTT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG351     GGGCCTTA  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG416      GGCCTTAA PPDB Motif  PLACE Motif 
REGCTTGGGCCTATTAACGGCCCATAT+86435828643605AT5G25080.1
 AtREG505CTTGGGCC                 PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356 TTGGGCCT                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358  TGGGCCTA               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG362   GGGCCTAT              PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG424    GGCCTATT             PPDB Motif  PLACE Motif 
 AtREG377            AACGGCCC     PPDB MotifGCCCA, AAACG(C/G)  PLACE MotifGGGCC 
 AtREG368             ACGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380              CGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG364               GGCCCATA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG432                GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGGCTGACGT+86436148643621AT5G25080.1
 AtREG515GCTGACGTSA PPDB MotifACGT  PLACE MotifACGT 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.