version
PlantPromoterDB promoter information of AT5G25440.1

Summary of Gene (AT5G25440.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G25440  TAIR      NCBI 
Gene model AT5G25440.1  
Description protein kinase family protein; FUNCTIONS IN: protein tyrosine kinase activity, protein kinase activity, kinase activity, ATP binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal protein myristoylation; LOCATED IN: nucleus, cytoplasm; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 9 growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase, core (InterPro:IPR000719), Tyrosine protein kinase (InterPro:IPR001245), Protein kinase-like (InterPro:IPR011009); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G11410.1); Has 37433 Blast hits to 37026 proteins in 1128 species: Archae - 24; Bacteria - 1745; Metazoa - 15094; Fungi - 1709; Plants - 13857; Viruses - 129; Other Eukaryotes - 4875 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 8857722-8856523)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G25440.1                      5'->3' (-)
Promoter sequence






 
AT5G25450.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G25440.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-8856758-36
TSS clone peakGclone-8856750-28
TSS cloneTclone-8856747-25

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCTCTTCTTC-88567628856774-40-52
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTGACTTT-88568008856807-78-85
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 
REGAAACGCGTTTT-88568108856820-88-98
 AtREG633AAACGCGTTT  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG566   CGCGTTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGTAAAACGCGT-88568368856845-114-123
 AtREG564TAAAACGC   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG566 AAAACGCG  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG633  AAACGCGT PPDB MotifAAACG(C/G)  PLACE Motif 
REGAAAACGGCGTCGT-88568598856871-137-149
 AtREG531AAAACGGC      PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG524 AAACGGCG     PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG497  AACGGCGT    PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 
 AtREG540   ACGGCGTC   PPDB Motif  PLACE Motif 
 AtREG537     GGCGTCGT PPDB Motif  PLACE Motif 
REGAAACGGCGT-88568908856898-168-176
 AtREG524AAACGGCG  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG497 AACGGCGT PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 
REGGAAACGACGCC-88570388857048-316-326
 AtREG576GAAACGAC    PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG   PPDB Motif  PLACE Motif 
 AtREG439  AACGACGC  PPDB Motif  PLACE Motif 
 AtREG537   ACGACGCC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4+8857000AT5G25450.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAAAGTCAA+88568008856807AT5G25450.1
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 
REGAAAACGCGTTT+88568108856820AT5G25450.1
 AtREG566AAAACGCG    PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG633 AAACGCGTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGACGCGTTTTA+88568368856845AT5G25450.1
 AtREG633ACGCGTTT   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG566 CGCGTTTT  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG564  GCGTTTTA PPDB MotifAAACG(C/G)  PLACE Motif 
REGACGACGCCGTTTT+88568598856871AT5G25450.1
 AtREG537ACGACGCC      PPDB Motif  PLACE Motif 
 AtREG540  GACGCCGT    PPDB Motif  PLACE Motif 
 AtREG497   ACGCCGTT   PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 
 AtREG524    CGCCGTTT  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG531     GCCGTTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGACGCCGTTT+88568908856898AT5G25450.1
 AtREG497ACGCCGTT  PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 
 AtREG524 CGCCGTTT PPDB MotifAAACG(C/G)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.