version
PlantPromoterDB promoter information of AT5G25450

Summary of Gene (AT5G25450)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G25450  TAIR      NCBI 
Gene model AT5G25450  
Description ubiquinol-cytochrome C reductase complex 14 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; INVOLVED IN: mitochondrial electron transport, ubiquinol to cytochrome c; LOCATED IN: mitochondrion, mitochondrial respiratory chain complex III, membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome bd ubiquinol oxidase, 14 kDa subunit (InterPro:IPR003197); BEST Arabidopsis thaliana protein match is: ubiquinol-cytochrome C reductase complex 14 kDa protein, putative (TAIR:AT4G32470.1); Has 242 Blast hits to 242 proteins in 78 species: Archae - 0; Bacteria - 0; Metazoa - 160; Fungi - 25; Plants - 51; Viruses - 0; Other Eukaryotes - 6 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 8856036-8857235)

Genome position     
from initiation codon
AT5G25450.1         
TSS from cDNA
TSS information
AT5G25450                        5'->3' (+)
Promoter sequence





 
AT5G25440.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G25450

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4+8857000-36

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAGTCAA+88568008856807-236-229
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 
REGAAAACGCGTTT+88568108856820-226-216
 AtREG566AAAACGCG    PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG633 AAACGCGTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGACGCGTTTTA+88568368856845-200-191
 AtREG633ACGCGTTT   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG566 CGCGTTTT  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG564  GCGTTTTA PPDB MotifAAACG(C/G)  PLACE Motif 
REGACGACGCCGTTTT+88568598856871-177-165
 AtREG537ACGACGCC      PPDB Motif  PLACE Motif 
 AtREG540  GACGCCGT    PPDB Motif  PLACE Motif 
 AtREG497   ACGCCGTT   PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 
 AtREG524    CGCCGTTT  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG531     GCCGTTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGACGCCGTTT+88568908856898-146-138
 AtREG497ACGCCGTT  PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 
 AtREG524 CGCCGTTT PPDB MotifAAACG(C/G)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-8856758AT5G25440.1
TSS clone peakGclone-8856750AT5G25440.1
TSS cloneTclone-8856747AT5G25440.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTCTCTTCTTC-88567628856774AT5G25440.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTGACTTT-88568008856807AT5G25440.1
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 
REGAAACGCGTTTT-88568108856820AT5G25440.1
 AtREG633AAACGCGTTT  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG566   CGCGTTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGTAAAACGCGT-88568368856845AT5G25440.1
 AtREG564TAAAACGC   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG566 AAAACGCG  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG633  AAACGCGT PPDB MotifAAACG(C/G)  PLACE Motif 
REGAAAACGGCGTCGT-88568598856871AT5G25440.1
 AtREG531AAAACGGC      PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG524 AAACGGCG     PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG497  AACGGCGT    PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 
 AtREG540   ACGGCGTC   PPDB Motif  PLACE Motif 
 AtREG537     GGCGTCGT PPDB Motif  PLACE Motif 
REGAAACGGCGT-88568908856898AT5G25440.1
 AtREG524AAACGGCG  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG497 AACGGCGT PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 
REGGAAACGACGCC-88570388857048AT5G25440.1
 AtREG576GAAACGAC    PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG   PPDB Motif  PLACE Motif 
 AtREG439  AACGACGC  PPDB Motif  PLACE Motif 
 AtREG537   ACGACGCC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.