version
PlantPromoterDB promoter information of AT5G25630.1

Summary of Gene (AT5G25630.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G25630  TAIR      NCBI 
Gene model AT5G25630.1  
Description pentatricopeptide (PPR) repeat-containing protein; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: protein kinase family protein (TAIR:AT5G21222.1); Has 19068 Blast hits to 5732 proteins in 184 species: Archae - 3; Bacteria - 21; Metazoa - 595; Fungi - 399; Plants - 17210; Viruses - 0; Other Eukaryotes - 840 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 8946426-8947625)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G25630.1                      5'->3' (+)
Promoter sequence





 
AT5G25625           
AT5G25625.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G25630.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG5+8947372-54

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+8947371-55
TSS cloneAclone+8947389-37
TSS cloneCclone+8947411-15
TSS cloneGclone+8947418-8
TSS cloneAclone+8947422-4

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGTGACGT+89471438947150-283-276
 AtREG489CGTGACGTABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT 
REGTAATTGGGCT+89471638947172-263-254
 AtREG600TAATTGGG   PPDB MotifGCCCA  PLACE Motif 
 AtREG418 AATTGGGC  PPDB MotifGCCCA  PLACE Motif 
 AtREG402  ATTGGGCT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGCTGGGCCTT+89471768947184-250-242
 AtREG410CTGGGCCT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353 TGGGCCTT PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGTGTCGTTTA+89472868947294-140-132
 AtREG569TGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG565 GTCGTTTA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.