version
PlantPromoterDB promoter information of AT5G26600.1

Summary of Gene (AT5G26600.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G26600  TAIR      NCBI 
Gene model AT5G26600.1  
Description catalytic/ pyridoxal phosphate binding; FUNCTIONS IN: pyridoxal phosphate binding, catalytic activity; INVOLVED IN: metabolic process; LOCATED IN: chloroplast; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Pyridoxal phosphate-dependent transferase, major region (InterPro:IPR015424), Aminotransferase, class V/Cysteine desulfurase (InterPro:IPR000192), Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (InterPro:IPR015421); BEST Arabidopsis thaliana protein match is: epimerase-related (TAIR:AT3G62130.1); Has 3925 Blast hits to 3925 proteins in 952 species: Archae - 92; Bacteria - 2185; Metazoa - 19; Fungi - 114; Plants - 63; Viruses - 1; Other Eukaryotes - 1451 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 9376455-9377654)

Genome position     
from initiation codon
AT5G26600.2         
AT5G26610.1         
AT5G26610.2         
TSS from cDNA
TSS information
AT5G26600.1                      5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G26600.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8+9377411-44

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+9377397-58
TSS cloneAclone+9377413-42

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTTCTTCTCTTCTTC+93774239377440-32-15
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGTTAAA+93771629377169-293-286
 AtREG610CCGTTAAA PPDB Motif  PLACE MotifYAACKG, CNGTTR 
REGCCGTTAAA+93771779377184-278-271
 AtREG610CCGTTAAA PPDB Motif  PLACE MotifYAACKG, CNGTTR 
REGAACACGTGA+93772319377239-224-216
 AtREG590AACACGTG ABA, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG628 ACACGTGADREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
REGGTCACGTG+93772829377289-173-166
 AtREG583GTCACGTG PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
REGCGTGGCAC+93773369377343-119-112
 AtREG444CGTGGCAC PPDB Motif  PLACE MotifGCCAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.