version
PlantPromoterDB promoter information of AT5G26820.1

Summary of Gene (AT5G26820.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G26820  TAIR      NCBI 
Gene model AT5G26820.1  
Description IRON-REGULATED PROTEIN 3 (ATIREG3); LOCATED IN: membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Major facilitator superfamily, general substrate transporter (InterPro:IPR016196); BEST Arabidopsis thaliana protein match is: ATIREG2 (IRON-REGULATED PROTEIN 2); nickel ion transmembrane transporter (TAIR:AT5G03570.1); Has 183 Blast hits to 183 proteins in 57 species: Archae - 0; Bacteria - 2; Metazoa - 84; Fungi - 42; Plants - 43; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 9432858-9434057)

Genome position     
from initiation codon
AT5G26810.1         
TSS from cDNA
TSS information
AT5G26820.1                      5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G26820.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+9433601-257

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACCGAACCG+94334039433411-455-447
 AtREG451ACCGAACC  PPDB Motif  PLACE Motif 
 AtREG456 CCGAACCG PPDB MotifAACCG(G/A)  PLACE Motif 
REGCGGTTCAA+94334219433428-437-430
 AtREG640CGGTTCAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAACCGAAC+94334489433456-410-402
 AtREG568AAACCGAA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556 AACCGAAC PPDB MotifAACCG(G/A)  PLACE Motif 
REGCGAACCGAACCA+94334689433479-390-379
 AtREG575CGAACCGA     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556  AACCGAAC   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451   ACCGAACC  PPDB Motif  PLACE Motif 
 AtREG655    CCGAACCA PPDB Motif  PLACE Motif 
REGCTACGTGGCTT+94335469433556-312-302
 AtREG495CTACGTGG    PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG413 TACGTGGC   PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG450  ACGTGGCT ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG608   CGTGGCTTABA PPDB Motif  PLACE MotifGCCAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.