version
PlantPromoterDB promoter information of AT5G27470.1

Summary of Gene (AT5G27470.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G27470  TAIR      NCBI 
Gene model AT5G27470.1  
Description seryl-tRNA synthetase / serine--tRNA ligase; FUNCTIONS IN: serine-tRNA ligase activity, aminoacyl-tRNA ligase activity, nucleotide binding, ATP binding; INVOLVED IN: response to cadmium ion, seryl-tRNA aminoacylation; LOCATED IN: cytosol; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: tRNA-binding arm (InterPro:IPR010978), Seryl-tRNA synthetase, class IIa, N-terminal (InterPro:IPR015866), Aminoacyl-tRNA synthetase, class II (G, H, P and S), conserved region (InterPro:IPR002314), Seryl-tRNA synthetase, class IIa (InterPro:IPR002317), Aminoacyl-tRNA synthetase, class II, conserved region (InterPro:IPR006195), Seryl-tRNA synthetase, class IIa, C-terminal (InterPro:IPR018156); BEST Arabidopsis thaliana protein match is: SRS (SERYL-TRNA SYNTHETASE); serine-tRNA ligase (TAIR:AT1G11870.2); Has 7169 Blast hits to 7168 proteins in 1635 species: Archae - 140; Bacteria - 3036; Metazoa - 295; Fungi - 180; Plants - 68; Viruses - 0; Other Eukaryotes - 3450 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 9694087-9695286)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G27470.1                      5'->3' (+)
Promoter sequence









 
AT5G27460.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence









 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G27470.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8+9695027-60

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+9695008-79
TSS cloneCclone+9695019-68
TSS cloneTclone+9695028-59
TSS cloneGclone+9695036-51

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCCTTCTTCTTCCTC+96949919695007-96-80
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGGTTCGGT+96948419694849-246-238
 AtREG655TGGTTCGG  PPDB Motif  PLACE Motif 
 AtREG451 GGTTCGGT PPDB Motif  PLACE Motif 
REGATTTGGGCCGTA+96948889694899-199-188
 AtREG421ATTTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414  TTGGGCCG   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG368   TGGGCCGT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG499    GGGCCGTA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGAGTTGGGCTTACCCGGCCCATAT+96949089694930-179-157
 AtREG607AGTTGGGC                PPDB MotifGCCCA  PLACE Motif 
 AtREG574 GTTGGGCT               PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426   TGGGCTTA             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG404           CCCGGCCC    CK PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG457            CCGGCCCA   CK PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380             CGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG364              GGCCCATA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG432               GCCCATAT PPDB MotifGCCCA  PLACE Motif 
REGATAAGCCC+96949399694946-148-141
 AtREG462ATAAGCCC PPDB MotifGCCCA  PLACE Motif 
REGGACGTCGT+96949599694966-128-121
 AtREG431GACGTCGT PPDB MotifACGT  PLACE MotifACGT 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-9694840AT5G27460.1
TSS clone peakAclone-9694823AT5G27460.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTCTCT-96948669694875AT5G27460.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTACGGCCCAAAT-96948889694899AT5G27460.1
 AtREG499TACGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG368 ACGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414  CGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373   GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG421    GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGATATGGGCCGGGTAAGCCCAACT-96949089694930AT5G27460.1
 AtREG432ATATGGGC                PPDB MotifGCCCA  PLACE Motif 
 AtREG364 TATGGGCC               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380  ATGGGCCG              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG457   TGGGCCGG            CK PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG404    GGGCCGGG           CK PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG426            TAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407             AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG574              AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG607               GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGGGGCTTAT-96949399694946AT5G27460.1
 AtREG462GGGCTTAT PPDB MotifGCCCA  PLACE Motif 
REGACGACGTC-96949599694966AT5G27460.1
 AtREG431ACGACGTC PPDB MotifACGT  PLACE MotifACGT 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.