PlantPromoterDB promoter information of AT5G27640.1
Summary of Gene (AT5G27640.1)
|
Overview
|
Focused view (chromosome 5: 9787659-9786460)
|
Genome position
from initiation codon TSS from cDNA TSS information AT5G27640.1 5'->3' (-) Promoter sequence AT5G27650.1
TSS from cDNA TSS information 3'->5' (+) Promoter sequence TSS tag distribution(+)
TSS tag distribution(-)
|
|
|
|
Promoter Summary of AT5G27640.1
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS peak | A | 13 | - | 9785240 | -481 |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone | T | clone | - | 9785288 | -529 |
| TSS clone | A | clone | - | 9785287 | -528 |
| TSS clone | T | clone | - | 9785220 | -461 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | CGTCTTCTTCTT | - | 9785223 | 9785234 | -464 | -475 |
| Y Patch | CTCCTTCTTCCTC | - | 9785247 | 9785259 | -488 | -500 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | GACGTCGT | - | 9785288 | 9785295 | -529 | -536 | |||
| AtREG431 | GACGTCGT | PPDB Motif | ACGT | PLACE Motif | ACGT | ||||
| REG | ATAAGCCC | - | 9785308 | 9785315 | -549 | -556 | |||
| AtREG462 | ATAAGCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | AATTGGGCTTACCCGGCCCATATA | - | 9785323 | 9785346 | -564 | -587 | |||
| AtREG418 | AATTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG402 | ATTGGGCT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG407 | TTGGGCTT | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG426 | TGGGCTTA | PPDB Motif | GCCCA | PLACE Motif | TGGGCY | ||||
| AtREG404 | CCCGGCCC | CK | PPDB Motif | GCCCA | PLACE Motif | GGGCC | |||
| AtREG457 | CCGGCCCA | CK | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | |||
| AtREG380 | CGGCCCAT | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG364 | GGCCCATA | PPDB Motif | GCCCA | PLACE Motif | GGGCC, TGGGCY | ||||
| AtREG432 | GCCCATAT | PPDB Motif | GCCCA | PLACE Motif | |||||
| AtREG620 | CCCATATA | PPDB Motif | GCCCA | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||