version
PlantPromoterDB promoter information of AT5G27650.1

Summary of Gene (AT5G27650.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G27650  TAIR      NCBI 
Gene model AT5G27650.1  
Description PWWP domain-containing protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: PWWP (InterPro:IPR000313); BEST Arabidopsis thaliana protein match is: PWWP domain-containing protein (TAIR:AT3G05430.1); Has 6970 Blast hits to 4442 proteins in 299 species: Archae - 10; Bacteria - 363; Metazoa - 3592; Fungi - 627; Plants - 302; Viruses - 141; Other Eukaryotes - 1935 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 9784511-9785710)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G27650.1                      5'->3' (+)
Promoter sequence










 
AT5G27640.1         
AT5G27640.2         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence










 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G27650.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA10+9785407-104

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+9785407-104

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTTCTCTC+97853769785385-135-126
Y PatchTCTCTTTC+97854199785426-92-85
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACGACGTC+97852889785295-223-216
 AtREG431ACGACGTC PPDB MotifACGT  PLACE MotifACGT 
REGGGGCTTAT+97853089785315-203-196
 AtREG462GGGCTTAT PPDB MotifGCCCA  PLACE Motif 
REGTATATGGGCCGGGTAAGCCCAATT+97853239785346-188-165
 AtREG620TATATGGG                 PPDB MotifGCCCA  PLACE Motif 
 AtREG432 ATATGGGC                PPDB MotifGCCCA  PLACE Motif 
 AtREG364  TATGGGCC               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380   ATGGGCCG              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG457    TGGGCCGG            CK PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG404     GGGCCGGG           CK PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG426             TAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407              AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402               AGCCCAAT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG418                GCCCAATT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA13-9785240AT5G27640.1, AT5G27640.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone-9785288AT5G27640.1, AT5G27640.2
TSS cloneAclone-9785287AT5G27640.1, AT5G27640.2
TSS cloneTclone-9785220AT5G27640.1, AT5G27640.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTTCTTCTT-97852239785234AT5G27640.1, AT5G27640.2
Y PatchCTCCTTCTTCCTC-97852479785259AT5G27640.1, AT5G27640.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGACGTCGT-97852889785295AT5G27640.1, AT5G27640.2
 AtREG431GACGTCGT PPDB MotifACGT  PLACE MotifACGT 
REGATAAGCCC-97853089785315AT5G27640.1, AT5G27640.2
 AtREG462ATAAGCCC PPDB MotifGCCCA  PLACE Motif 
REGAATTGGGCTTACCCGGCCCATATA-97853239785346AT5G27640.1, AT5G27640.2
 AtREG418AATTGGGC                 PPDB MotifGCCCA  PLACE Motif 
 AtREG402 ATTGGGCT                PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426   TGGGCTTA              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG404           CCCGGCCC     CK PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG457            CCGGCCCA    CK PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380             CGGCCCAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG364              GGCCCATA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG432               GCCCATAT  PPDB MotifGCCCA  PLACE Motif 
 AtREG620                CCCATATA PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.