version
PlantPromoterDB promoter information of AT5G35210.1

Summary of Gene (AT5G35210.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G35210  TAIR      NCBI 
Gene model AT5G35210.1  
Description peptidase M50 family protein / sterol-regulatory element binding protein (SREBP) site 2 protease family protein; FUNCTIONS IN: protein binding, DNA binding, metalloendopeptidase activity, zinc ion binding; INVOLVED IN: proteolysis, regulation of transcription, DNA-dependent; LOCATED IN: nucleus, chloroplast envelope; EXPRESSED IN: male gametophyte; EXPRESSED DURING: M germinated pollen stage; CONTAINS InterPro DOMAIN/s: DDT family (InterPro:IPR004022), Zinc finger, PHD-type (InterPro:IPR001965), Peptidase M50 (InterPro:IPR008915), DDT superfamily (InterPro:IPR018501), DDT subgroup (InterPro:IPR018500), Zinc finger, RING/FYVE/PHD-type (InterPro:IPR013083), Zinc finger, FYVE/PHD-type (InterPro:IPR011011); BEST Arabidopsis thaliana protein match is: PHD finger family protein (TAIR:AT5G22760.1); Has 3280 Blast hits to 2945 proteins in 255 species: Archae - 62; Bacteria - 178; Metazoa - 2100; Fungi - 246; Plants - 447; Viruses - 0; Other Eukaryotes - 247 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 13483238-13482039)

Genome position     
from initiation codon
AT5G35210.2         
TSS from cDNA
TSS information
AT5G35210.1                      5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G35210.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13-13482607-369

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTTCTTCTTC-1348255813482571-320-333
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAAGGCCCAAAC-1348266813482679-430-441
 AtREG398CAAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353 AAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373   GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG474    GCCCAAAC PPDB MotifGCCCA  PLACE Motif 
REGCAGGCCCAAG-1348274113482750-503-512
 AtREG370CAGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356 AGGCCCAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG505  GGCCCAAG PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGCAAGGCCCAAAGGCCCAAAA-1348275813482777-520-539
 AtREG398CAAGGCCC             PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353 AAGGCCCAAAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  AGGCCCAAAGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373   GGCCCAAAGGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG656       CAAAGGCC      PPDB Motif  PLACE Motif 
 AtREG359        AAAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG529            GCCCAAAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.