version
PlantPromoterDB promoter information of AT5G37510.1

Summary of Gene (AT5G37510.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G37510  TAIR      NCBI 
Gene model AT5G37510.1  
Description Encodes a subunit of the 400 kDa subcomplex of the mitochondrial NADH dehydrogenase (complex I). The protein has been isolated in the male gametophyte.  
#
#

Overview

Focused view (chromosome 5: 14896490-14897689)

Genome position     
from initiation codon
AT5G37510.2         
TSS from cDNA
TSS information
AT5G37510.1                      5'->3' (+)
Promoter sequence












 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G37510.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG13+14897431-59

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+14897410-80
TSS cloneGclone+14897411-79
TSS cloneAclone+14897420-70
TSS cloneAclone+14897432-58
TSS cloneAclone+14897434-56
TSS cloneAclone+14897440-50
TSS cloneCclone+14897441-49

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCCTTCTCTCTC+1489738314897396-107-94
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAAAGCCCACAAAGCCCAAAA+1489729014897311-200-179
 AtREG589AAAAAGCC               PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC              PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG518   AAGCCCAC            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG559          CAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG407            AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469             AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG529              GCCCAAAA PPDB MotifGCCCA  PLACE Motif 
REGTAAAAGCCCATAAAGCCCAAAA+1489734714897368-143-122
 AtREG549TAAAAGCC               PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC              PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   AAGCCCAT            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477    AGCCCATA           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG394     GCCCATAA          PPDB MotifGCCCA  PLACE Motif 
 AtREG601         ATAAAGCC      PPDB Motif  PLACE Motif 
 AtREG365          TAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG407            AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469             AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG529              GCCCAAAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.