version
PlantPromoterDB promoter information of AT5G39250.1

Summary of Gene (AT5G39250.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G39250  TAIR      NCBI 
Gene model AT5G39250.1  
Description F-box family protein; FUNCTIONS IN: molecular_function unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810); Has 35 Blast hits to 35 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 0; Plants - 27; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 15723860-15725059)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G39250.1                      5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G39250.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2+15724489-371

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+15724488-372
TSS cloneAclone+15724530-330
TSS cloneAclone+15724531-329

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAGTCAA+1572426515724272-595-588
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 
REGCTAATGGGCTTTGGGCCGGGCCGTT+1572431515724339-545-521
 AtREG558CTAATGGG                  PPDB MotifGCCCA  PLACE Motif 
 AtREG357 TAATGGGC                 PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT                PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   ATGGGCTT               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376    TGGGCTTT              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG559     GGGCTTTG             PPDB MotifGCCCA  PLACE Motif 
 AtREG373         TTTGGGCC         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414          TTGGGCCG        PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG457           TGGGCCGG      CK PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG404            GGGCCGGG     CK PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG377                 GGGCCGTT PPDB MotifGCCCA, AAACG(C/G)  PLACE MotifGGGCC 
REGTAATTGGGCTTCTATATGGGCTAAGGCCTTTT+1572439915724430-461-430
 AtREG600TAATTGGG                         PPDB MotifGCCCA  PLACE Motif 
 AtREG418 AATTGGGC                        PPDB MotifGCCCA  PLACE Motif 
 AtREG402  ATTGGGCT                       PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   TTGGGCTT                      PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG476    TGGGCTTC                     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG620            TATATGGG             PPDB MotifGCCCA  PLACE Motif 
 AtREG432             ATATGGGC            PPDB MotifGCCCA  PLACE Motif 
 AtREG477              TATGGGCT           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581               ATGGGCTA          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG571                TGGGCTAA         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG577                    CTAAGGCC     PPDB Motif  PLACE Motif 
 AtREG459                        GGCCTTTT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.