version
PlantPromoterDB promoter information of AT5G39950.1

Summary of Gene (AT5G39950.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G39950  TAIR      NCBI 
Gene model AT5G39950.1  
Description encodes a cytosolic thioredoxin that reduces disulfide bridges of target proteins by the reversible formation of a disulfide bridge between two neighboring Cys residues present in the active site. Thioredoxins have been found to regulate a variety of biological reactions in prokaryotic and eukaryotic cells.  
#
#

Overview

Focused view (chromosome 5: 15992881-15991682)

Genome position     
from initiation codon
AT5G39955.1         
TSS from cDNA
TSS information
AT5G39950.1                      5'->3' (-)
Promoter sequence





 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G39950.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG51-15991892-11

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-15991930-49
TSS cloneGclone-15991892-11
TSS cloneAclone-15991891-10
TSS cloneGclone-15991888-7
TSS cloneAclone-15991887-6

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAACGACACG-1599195115991961-70-80
 AtREG565TAAACGAC    PPDB Motif  PLACE Motif 
 AtREG569 AAACGACA   PPDB Motif  PLACE Motif 
 AtREG527  AACGACAC DREB1Aox PPDB Motif  PLACE Motif 
 AtREG428   ACGACACGABA, DREB1Aox, Ethylene, Drought PPDB Motif  PLACE Motif 
REGAAACGGCACG-1599197415991983-93-102
 AtREG500AAACGGCA   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG522  ACGGCACG PPDB Motif  PLACE Motif 
REGTAAATGGGCTAA-1599202515992036-144-155
 AtREG443TAAATGGG     PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG372  AATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581   ATGGGCTA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG571    TGGGCTAA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTAAATGGG-1599204515992052-164-171
 AtREG443TAAATGGG PPDB MotifGCCCA  PLACE Motif 
REGTAAATGGGC-1599208315992091-202-210
 AtREG443TAAATGGG  PPDB MotifGCCCA  PLACE Motif 
 AtREG386 AAATGGGC PPDB MotifGCCCA  PLACE Motif 
REGTAAATGGG-1599210215992109-221-228
 AtREG443TAAATGGG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.