version
PlantPromoterDB promoter information of AT5G41150.2

Summary of Gene (AT5G41150.2)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G41150  TAIR      NCBI 
Gene model AT5G41150.2  
Description Confers resistance to UV radiation. Homolog of the human xeroderma pigmentosum group F DNA repair and yeast Rad1 proteins  
#
#

Overview

Focused view (chromosome 5: 16477919-16476720)

Genome position     
from initiation codon
AT5G41150.1         
TSS from cDNA
TSS information
AT5G41150.2                      5'->3' (-)
Promoter sequence









 
AT5G41160.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G41150.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA5-16476951-32

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-16476951-32

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTTCTTC-1647692116476930-2-11
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTGACCC-1647699116476998-72-79
 AtREG592TTTGACCC PPDB Motif  PLACE MotifTTGAC, TTGACC 
REGTAAACGACGCCGTTTTGA-1647701116477028-92-109
 AtREG565TAAACGAC           PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG          PPDB Motif  PLACE Motif 
 AtREG439  AACGACGC         PPDB Motif  PLACE Motif 
 AtREG537   ACGACGCC        PPDB Motif  PLACE Motif 
 AtREG540     GACGCCGT      PPDB Motif  PLACE Motif 
 AtREG497      ACGCCGTT     PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 
 AtREG524       CGCCGTTT    PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG531        GCCGTTTT   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG653          CGTTTTGA PPDB MotifAAACG(C/G)  PLACE Motif 
REGAAACCGGTTT-1647704516477054-126-135
 AtREG436AAACCGGTTT PPDB MotifAACCG(G/A)  PLACE Motif 
REGCTAAACCGGTTAAG-1647707916477092-160-173
 AtREG511CTAAACCG       PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436  AAACCGGT     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG503    ACCGGTTA   PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG501     CCGGTTAA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG605      CGGTTAAG PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.