version
PlantPromoterDB promoter information of AT5G41760.2

Summary of Gene (AT5G41760.2)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G41760  TAIR      NCBI 
Gene model AT5G41760.2  
Description nucleotide-sugar transporter family protein; FUNCTIONS IN: nucleotide-sugar transmembrane transporter activity, CMP-sialic acid transmembrane transporter activity; INVOLVED IN: carbohydrate transport, nucleotide-sugar transport; LOCATED IN: endomembrane system, integral to membrane, Golgi membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Nucleotide-sugar transporter (InterPro:IPR007271), UDP-galactose transporter (InterPro:IPR004689); BEST Arabidopsis thaliana protein match is: nucleotide-sugar transmembrane transporter/ sugar:hydrogen symporter (TAIR:AT4G35335.1); Has 819 Blast hits to 807 proteins in 131 species: Archae - 0; Bacteria - 0; Metazoa - 511; Fungi - 85; Plants - 92; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 16706078-16707277)

Genome position     
from initiation codon
AT5G41760.1         
TSS from cDNA
TSS information
AT5G41760.2                      5'->3' (+)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G41760.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4+16706895-83

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAGCGTTT+1670674216706749-236-229
 AtREG626CAGCGTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGCAAGGCCCATAA+1670678816706799-190-179
 AtREG398CAAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353 AAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  AGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG364   GGCCCATA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG394    GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGTAAAAGCCCAAAGGCCCAGA+1670681216706831-166-147
 AtREG549TAAAAGCC             PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC            PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   AAGCCCAA          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469    AGCCCAAA         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG656        CAAAGGCC     PPDB Motif  PLACE Motif 
 AtREG359         AAAGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353          AAGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG410           AGGCCCAG  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG397            GGCCCAGA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.