version
PlantPromoterDB promoter information of AT5G43260.1

Summary of Gene (AT5G43260.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G43260  TAIR      NCBI 
Gene model AT5G43260.1  
Description chaperone protein dnaJ-related; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; Has 66 Blast hits to 65 proteins in 21 species: Archae - 0; Bacteria - 15; Metazoa - 2; Fungi - 0; Plants - 37; Viruses - 0; Other Eukaryotes - 12 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 17358986-17357787)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G43260.1                      5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G43260.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2-17358039-53

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCTCTCTCTT-1735800017358011-14-25
Y PatchCGTCTCTCTTCTTC-1735806817358081-82-95
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATAAACCGAACCG-1735815417358166-168-180
 AtREG598ATAAACCG      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514 TAAACCGA     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556   AACCGAAC   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451    ACCGAACC  PPDB Motif  PLACE Motif 
 AtREG456     CCGAACCG PPDB MotifAACCG(G/A)  PLACE Motif 
REGCCCACGTGTT-1735821617358225-230-239
 AtREG464CCCACGTG  ABA, Auxin, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG382 CCACGTGT ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG590  CACGTGTTABA, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
REGAGCCCAATAA-1735831017358319-324-333
 AtREG402AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355 GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG417  CCCAATAA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.