PlantPromoterDB promoter information of AT5G43440

Summary of Gene (AT5G43440)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G43440  TAIR      NCBI 
Gene model AT5G43440  
Description encodes a protein whose sequence is similar to ACC oxidase  


Focused view (chromosome 5: 17454008-17452809)

Genome position     
from initiation codon
TSS from cDNA
TSS information
AT5G43440                        5'->3' (-)
Promoter sequence

TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

TSS tag distribution(+)

TSS tag distribution(-)


Promoter Summary of AT5G43440

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
TSS clone peakGclone-17456657-49
TSS clone peakAclone-17456621-13

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
TSS peakC2+17453607AT5G43430.1, AT5G43430.2, AT5G43430.3
TSS peakA2+17453615AT5G43430.1, AT5G43430.2, AT5G43430.3

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
TSS cloneAclone+17453608AT5G43430.1, AT5G43430.2, AT5G43430.3
TSS cloneAclone+17453610AT5G43430.1, AT5G43430.2, AT5G43430.3
TSS cloneTclone+17453638AT5G43430.1, AT5G43430.2, AT5G43430.3

Core promoter information

TypeSequenceGenome positionGene model
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
REGGGCCTAAA+1745348617453493AT5G43430.1, AT5G43430.2, AT5G43430.3
REGCTAAACCGGATTAAACCGAA+1745353917453558AT5G43430.1, AT5G43430.2, AT5G43430.3
 AtREG511CTAAACCG             PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG            PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521  AAACCGGA           PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561   AACCGGAT          PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG473          TTAAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG514           TAAACCGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568            AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.