version
PlantPromoterDB promoter information of AT5G43970.1

Summary of Gene (AT5G43970.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G43970  TAIR      NCBI 
Gene model AT5G43970.1  
Description Subunit of the TOM complex, a translocase in the outer mitochondrial membrane that selectively allows proteins with a mitochondrial targeting sequence to enter the mitochondrion.  
#
#

Overview

Focused view (chromosome 5: 17691888-17693087)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G43970.1                      5'->3' (+)
Promoter sequence











 
AT5G43960.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence



 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G43970.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG26+17692828-60

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+17692808-80

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAATTGGGCTTTTATGGCCCAAT+1769270317692725-185-163
 AtREG600TAATTGGG                PPDB MotifGCCCA  PLACE Motif 
 AtREG418 AATTGGGC               PPDB MotifGCCCA  PLACE Motif 
 AtREG402  ATTGGGCT              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   TTGGGCTT             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376    TGGGCTTT            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409     GGGCTTTT           PPDB MotifGCCCA  PLACE Motif 
 AtREG549      GGCTTTTA          PPDB Motif  PLACE Motif 
 AtREG479            TATGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG437             ATGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420              TGGCCCAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352               GGCCCAAT PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGATGGCCCAAAT+1769275517692765-133-123
 AtREG437ATGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420 TGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373  GGCCCAAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG421   GCCCAAAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4-17691925AT5G43960.2, AT5G43960.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-17691939AT5G43960.2, AT5G43960.1
TSS cloneTclone-17691892AT5G43960.2, AT5G43960.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTTCTTC-1769188117691888AT5G43960.1, AT5G43960.2
Y PatchTCTCTCTCTC-1769191417691923AT5G43960.1, AT5G43960.2
Y PatchCCTCCTCTT-1769196717691975AT5G43960.1, AT5G43960.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.