version
PlantPromoterDB promoter information of AT5G47090.1

Summary of Gene (AT5G47090.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G47090  TAIR      NCBI 
Gene model AT5G47090.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF2052, coiled-coil (InterPro:IPR018613); Has 8880 Blast hits to 4216 proteins in 240 species: Archae - 24; Bacteria - 100; Metazoa - 5830; Fungi - 499; Plants - 280; Viruses - 264; Other Eukaryotes - 1883 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 19126274-19127473)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G47090.1                      5'->3' (+)
Promoter sequence







 
AT5G47080.1         
AT5G47080.2         
AT5G47080.3         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence


 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G47090.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG13+19127260-14

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+19127260-14
TSS cloneGclone+19127266-8

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGTCACGT+1912702919127036-245-238
 AtREG606TGTCACGTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGATGGCCCAAGAAAGCCCAACA+1912715319127173-121-101
 AtREG437ATGGCCCA              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420 TGGCCCAA             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG505  GGCCCAAG            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG376          AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407           AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG574            AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG543             GCCCAACA PPDB MotifGCCCA  PLACE MotifCAACA 
REGTGTCACGTGAC+1912719719127207-77-67
 AtREG606TGTCACGT   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG583 GTCACGTGAC PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG18-19126575AT5G47080.1, AT5G47080.2, AT5G47080.3

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-19126611AT5G47080.1, AT5G47080.2, AT5G47080.3
TSS cloneAclone-19126565AT5G47080.1, AT5G47080.2, AT5G47080.3
TSS cloneAclone-19126548AT5G47080.1, AT5G47080.2, AT5G47080.3
TSS cloneAclone-19126547AT5G47080.1, AT5G47080.2, AT5G47080.3

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTTCTCT-1912659419126602AT5G47080.1, AT5G47080.2, AT5G47080.3
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTACCCCT-1912665619126663AT5G47080.1, AT5G47080.2, AT5G47080.3
 AtREG642TTACCCCT PPDB MotifACCCCT  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.