version
PlantPromoterDB promoter information of AT5G47860.1

Summary of Gene (AT5G47860.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G47860  TAIR      NCBI 
Gene model AT5G47860.1  
Description unknown protein; LOCATED IN: chloroplast; EXPRESSED IN: guard cell; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1350 (InterPro:IPR010765); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT3G43540.1); Has 289 Blast hits to 289 proteins in 66 species: Archae - 0; Bacteria - 111; Metazoa - 0; Fungi - 0; Plants - 41; Viruses - 0; Other Eukaryotes - 137 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 19380656-19381855)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G47860.1                      5'->3' (+)
Promoter sequence






 
AT5G47850.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence


 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G47860.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG4+19381565-91

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+19381633-23

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAGGGCTT+1938137719381384-279-272
 AtREG651TAGGGCTT PPDB Motif  PLACE Motif 
REGCGTCATTT+1938141719381424-239-232
 AtREG657CGTCATTT PPDB Motif  PLACE Motif 
REGGTGGCCCATTAAG+1938143819381450-218-206
 AtREG445GTGGCCCA      PPDB MotifGCCCA  PLACE MotifGCCAC, GGGCC, TGGGCY 
 AtREG490 TGGCCCAT     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361  GGCCCATT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357   GCCCATTA   PPDB MotifGCCCA  PLACE Motif 
 AtREG396    CCCATTAA  PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG604     CCATTAAG PPDB Motif  PLACE MotifTTAATGG 
REGGAAGCCCAATTA+1938145819381469-198-187
 AtREG476GAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407 AAGCCCAA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402  AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG418   GCCCAATT  PPDB MotifGCCCA  PLACE Motif 
 AtREG600    CCCAATTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA5-19381082AT5G47850.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-19381082AT5G47850.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTTCTTC-1938106019381068AT5G47850.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAACCGCGT-1938112819381135AT5G47850.1
 AtREG441AACCGCGTDrought PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.