version
PlantPromoterDB promoter information of AT5G49500.1

Summary of Gene (AT5G49500.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G49500  TAIR      NCBI 
Gene model AT5G49500.1  
Description signal recognition particle 54 kDa protein 2 / SRP54 (SRP-54B); FUNCTIONS IN: 7S RNA binding, mRNA binding, GTP binding; INVOLVED IN: SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition, SRP-dependent cotranslational protein targeting to membrane; LOCATED IN: signal recognition particle, signal recognition particle, endoplasmic reticulum targeting; EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s: Signal recognition particle, SRP54 subunit, helical bundle (InterPro:IPR013822), Signal recognition particle, SRP54 subunit, M-domain (InterPro:IPR004125), Signal recognition particle, SRP54 subunit (InterPro:IPR006325), Signal recognition particle, SRP54 subunit, GTPase (InterPro:IPR000897); BEST Arabidopsis thaliana protein match is: signal recognition particle 54 kDa protein 3 / SRP54 (SRP-54C) (TAIR:AT1G48900.1); Has 11534 Blast hits to 11529 proteins in 1579 species: Archae - 312; Bacteria - 5455; Metazoa - 259; Fungi - 192; Plants - 147; Viruses - 0; Other Eukaryotes - 5169 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 20081206-20080007)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G49500.1                      5'->3' (-)
Promoter sequence

 
AT5G49510.1         
AT5G49510.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G49500.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-20080331-125

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakT4+20080634AT5G49510.1, AT5G49510.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+20080615AT5G49510.1, AT5G49510.2
TSS cloneAclone+20080621AT5G49510.1, AT5G49510.2
TSS cloneGclone+20080639AT5G49510.1, AT5G49510.2
TSS cloneTclone+20080645AT5G49510.1, AT5G49510.2
TSS cloneGclone+20080648AT5G49510.1, AT5G49510.2
TSS cloneAclone+20080670AT5G49510.1, AT5G49510.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGATAAACCGGTTA+2008036920080380AT5G49510.1, AT5G49510.2
 AtREG598ATAAACCG     PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436  AAACCGGT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG503    ACCGGTTA PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
REGTCAAAACGATGGGCTTA+2008038420080400AT5G49510.1, AT5G49510.2
 AtREG653TCAAAACG          PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG378        ATGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG426         TGGGCTTA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGATAGGCCCAATAG+2008041120080423AT5G49510.1, AT5G49510.2
 AtREG362ATAGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358 TAGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  AGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352   GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355    GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG624     CCCAATAG PPDB MotifGCCCA  PLACE Motif 
REGGAACCGGCCTAAT+2008051020080522AT5G49510.1, AT5G49510.2
 AtREG637GAACCGGC      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG506     GGCCTAAT PPDB Motif  PLACE Motif 
REGAACCGCGT+2008053320080540AT5G49510.1, AT5G49510.2
 AtREG441AACCGCGTDrought PPDB Motif  PLACE Motif 
REGTAATGGGCCTG+2008055420080564AT5G49510.1, AT5G49510.2
 AtREG357TAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG361 AATGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  ATGGGCCT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG370   TGGGCCTG PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGGGCCTTTT+2008056820080575AT5G49510.1, AT5G49510.2
 AtREG459GGCCTTTT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.