version
PlantPromoterDB promoter information of AT5G50240.3

Summary of Gene (AT5G50240.3)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G50240  TAIR      NCBI 
Gene model AT5G50240.3  
Description L-isoaspartyl methyltransferase 2 (PIMT2)gene, alternatively spliced.  
#
#

Overview

Focused view (chromosome 5: 20450671-20451870)

Genome position     
from initiation codon
AT5G50240.1         
AT5G50240.2         
TSS from cDNA
TSS information
AT5G50240.3                      5'->3' (+)
Promoter sequence














 
AT5G50230.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G50240.3

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA5+20451277-394
TSS peakA8+20451452-219

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+20451381-290

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTC+2045145420451461-217-210
Y PatchCTCTCTTCTTCC+2045147420451485-197-186
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTATTGGGCCTATAAAAGCCCATTTA+2045114220451167-529-504
 AtREG417TTATTGGG                   PPDB MotifGCCCA  PLACE Motif 
 AtREG355 TATTGGGC                  PPDB MotifGCCCA  PLACE Motif 
 AtREG352  ATTGGGCC                 PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   TTGGGCCT                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358    TGGGCCTA               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG362     GGGCCTAT              PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG487      GGCCTATA             PPDB Motif  PLACE Motif 
 AtREG549            TAAAAGCC       PPDB Motif  PLACE Motif 
 AtREG409             AAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG376              AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378               AAGCCCAT    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372                AGCCCATT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG386                 GCCCATTT  PPDB MotifGCCCA  PLACE Motif 
 AtREG443                  CCCATTTA PPDB MotifGCCCA  PLACE Motif 
REGCACGTCAT+2045120720451214-464-457
 AtREG483CACGTCAT PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGGTCCACGTGGCAA+2045121620451228-455-443
 AtREG513GTCCACGT     ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG408 TCCACGTG    ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG367   CACGTGGC  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG379    ACGTGGCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG452     CGTGGCAA PPDB Motif  PLACE MotifGCCAC 
REGCGCCACGTAG+2045139320451402-278-269
 AtREG371CGCCACGT  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG413 GCCACGTA  PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG495  CCACGTAG PPDB MotifACGT  PLACE MotifACGT, ACGTG 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.