version
PlantPromoterDB promoter information of AT5G50805

Summary of Gene (AT5G50805)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G50805  TAIR      NCBI 
Gene model AT5G50805  
Description pre-tRNA  
#
#

Overview

Focused view (chromosome 5: 20677372-20676173)

Genome position     
AT5G50810.1         
TSS from cDNA
TSS information
AT5G50805                        5'->3' (-)
Promoter sequence













 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G50805

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA4-20676580AT5G50810.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-20676586AT5G50810.1
TSS cloneAclone-20676563AT5G50810.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTTCTCCTTCTTCTTCTTC-2067653420676555AT5G50810.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTGGCCCAATAAG-2067664220676654AT5G50810.1
 AtREG484TTGGCCCA      PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420 TGGCCCAA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352  GGCCCAAT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355   GCCCAATA   PPDB MotifGCCCA  PLACE Motif 
 AtREG417    CCCAATAA  PPDB MotifGCCCA  PLACE Motif 
 AtREG611     CCAATAAG PPDB Motif  PLACE Motif 
REGTGTTGGGCTTTTAATGGG-2067665920676676AT5G50810.1
 AtREG543TGTTGGGC           PPDB MotifGCCCA  PLACE MotifCAACA 
 AtREG574 GTTGGGCT          PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG407  TTGGGCTT         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376   TGGGCTTT        PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG409    GGGCTTTT       PPDB MotifGCCCA  PLACE Motif 
 AtREG549     GGCTTTTA      PPDB Motif  PLACE Motif 
 AtREG396          TTAATGGG PPDB MotifGCCCA  PLACE MotifTTAATGG 
REGTCGGCCCAGA-2067673520676744AT5G50810.1
 AtREG393TCGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG397  GGCCCAGA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGTTAAACCGGTCGGGTCCG-2067678820676805AT5G50810.1
 AtREG473TTAAACCG           PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG          PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436  AAACCGGT         PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG552   AACCGGTC        PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG405       GGTCGGGT    PPDB MotifCCGAC  PLACE MotifCCGAC 
 AtREG390        GTCGGGTC   PPDB MotifCCGAC, GGGACCC  PLACE MotifCCGAC 
 AtREG491          CGGGTCCG PPDB Motif  PLACE Motif 
REGGTCCGGTTTT-2067684520676854AT5G50810.1
 AtREG573GTCCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521 TCCGGTTT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG542  CCGGTTTT PPDB MotifAACCG(G/A)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.