version
PlantPromoterDB promoter information of AT5G51110.1

Summary of Gene (AT5G51110.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G51110  TAIR      NCBI 
Gene model AT5G51110.1  
Description 4-alpha-hydroxytetrahydrobiopterin dehydratase; FUNCTIONS IN: 4-alpha-hydroxytetrahydrobiopterin dehydratase activity; INVOLVED IN: tetrahydrobiopterin biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Transcriptional coactivator/pterin dehydratase (InterPro:IPR001533); BEST Arabidopsis thaliana protein match is: dehydratase family (TAIR:AT1G29810.1); Has 1563 Blast hits to 1563 proteins in 256 species: Archae - 17; Bacteria - 489; Metazoa - 0; Fungi - 2; Plants - 42; Viruses - 0; Other Eukaryotes - 1013 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 20780380-20779181)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G51110.1                      5'->3' (-)
Promoter sequence





 
AT5G51120.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G51110.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8-20779434-54

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-20779434-54
TSS cloneTclone-20779430-50

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTACGTGGCAC-2077947620779485-96-105
 AtREG413TACGTGGC   PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG379 ACGTGGCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG444  CGTGGCAC PPDB Motif  PLACE MotifGCCAC 
REGCCCATTAG-2077949720779504-117-124
 AtREG558CCCATTAG PPDB MotifGCCCA  PLACE Motif 
REGAGTCGGTCCCAC-2077952220779533-142-153
 AtREG638AGTCGGTC    DREB1Aox, ABA PPDB MotifCCGAC  PLACE MotifCCGAC, RCCGAC 
 AtREG406    GGTCCCAC PPDB MotifGGGACCC  PLACE Motif 
REGCGTGACGTGT-2077953620779545-156-165
 AtREG489CGTGACGT  ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT 
 AtREG466 GTGACGTG ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG517  TGACGTGTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGCAATGGGCTTC-2077955720779567-177-187
 AtREG551CAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG372 AATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  ATGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG476   TGGGCTTC PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTAGGGCTT-2077968620779693-306-313
 AtREG651TAGGGCTT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG5+20779717AT5G51120.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+20779701AT5G51120.1
TSS cloneGclone+20779717AT5G51120.1
TSS cloneTclone+20779719AT5G51120.1
TSS cloneAclone+20779723AT5G51120.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTAAATGGG+2077946420779471AT5G51120.1
 AtREG443TAAATGGG PPDB MotifGCCCA  PLACE Motif 
REGGTGCCACGTA+2077947620779485AT5G51120.1
 AtREG444GTGCCACG   PPDB Motif  PLACE MotifGCCAC 
 AtREG379 TGCCACGT ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG413  GCCACGTA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
REGCTAATGGG+2077949720779504AT5G51120.1
 AtREG558CTAATGGG PPDB MotifGCCCA  PLACE Motif 
REGGTGGGACCGACT+2077952220779533AT5G51120.1
 AtREG406GTGGGACC     PPDB MotifGGGACCC  PLACE Motif 
 AtREG638    GACCGACTDREB1Aox, ABA PPDB MotifCCGAC  PLACE MotifCCGAC, RCCGAC 
REGACACGTCACG+2077953620779545AT5G51120.1
 AtREG517ACACGTCA  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG466 CACGTCAC ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG489  ACGTCACGABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT 
REGGAAGCCCATTG+2077955720779567AT5G51120.1
 AtREG476GAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372  AGCCCATT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG551   GCCCATTG PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.