version
PlantPromoterDB promoter information of AT5G51120.1

Summary of Gene (AT5G51120.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G51120  TAIR      NCBI 
Gene model AT5G51120.1  
Description Encodes a homolog of the protein PABN1, a polyadenylation factor subunit.  
#
#

Overview

Focused view (chromosome 5: 20778760-20779959)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G51120.1                      5'->3' (+)
Promoter sequence





 
AT5G51110.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G51120.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG5+20779717-43

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+20779701-59
TSS cloneGclone+20779717-43
TSS cloneTclone+20779719-41
TSS cloneAclone+20779723-37

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAAATGGG+2077946420779471-296-289
 AtREG443TAAATGGG PPDB MotifGCCCA  PLACE Motif 
REGGTGCCACGTA+2077947620779485-284-275
 AtREG444GTGCCACG   PPDB Motif  PLACE MotifGCCAC 
 AtREG379 TGCCACGT ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG413  GCCACGTA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
REGCTAATGGG+2077949720779504-263-256
 AtREG558CTAATGGG PPDB MotifGCCCA  PLACE Motif 
REGGTGGGACCGACT+2077952220779533-238-227
 AtREG406GTGGGACC     PPDB MotifGGGACCC  PLACE Motif 
 AtREG638    GACCGACTDREB1Aox, ABA PPDB MotifCCGAC  PLACE MotifCCGAC, RCCGAC 
REGACACGTCACG+2077953620779545-224-215
 AtREG517ACACGTCA  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG466 CACGTCAC ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG489  ACGTCACGABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT 
REGGAAGCCCATTG+2077955720779567-203-193
 AtREG476GAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372  AGCCCATT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG551   GCCCATTG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG8-20779434AT5G51110.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-20779434AT5G51110.1
TSS cloneTclone-20779430AT5G51110.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTACGTGGCAC-2077947620779485AT5G51110.1
 AtREG413TACGTGGC   PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG379 ACGTGGCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG444  CGTGGCAC PPDB Motif  PLACE MotifGCCAC 
REGCCCATTAG-2077949720779504AT5G51110.1
 AtREG558CCCATTAG PPDB MotifGCCCA  PLACE Motif 
REGAGTCGGTCCCAC-2077952220779533AT5G51110.1
 AtREG638AGTCGGTC    DREB1Aox, ABA PPDB MotifCCGAC  PLACE MotifCCGAC, RCCGAC 
 AtREG406    GGTCCCAC PPDB MotifGGGACCC  PLACE Motif 
REGCGTGACGTGT-2077953620779545AT5G51110.1
 AtREG489CGTGACGT  ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT 
 AtREG466 GTGACGTG ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG517  TGACGTGTABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGCAATGGGCTTC-2077955720779567AT5G51110.1
 AtREG551CAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG372 AATGGGCT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378  ATGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG476   TGGGCTTC PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTAGGGCTT-2077968620779693AT5G51110.1
 AtREG651TAGGGCTT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.